Incidental Mutation 'R1270:Muc1'
ID 151268
Institutional Source Beutler Lab
Gene Symbol Muc1
Ensembl Gene ENSMUSG00000042784
Gene Name mucin 1, transmembrane
Synonyms EMA, CD227, Muc-1
MMRRC Submission 039336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock # R1270 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 89229057-89233381 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89232107 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 605 (Y605N)
Ref Sequence ENSEMBL: ENSMUSP00000041963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041022] [ENSMUST00000041142] [ENSMUST00000090924] [ENSMUST00000107464] [ENSMUST00000143637]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041022
SMART Domains Protein: ENSMUSP00000036053
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 271 395 3e-13 BLAST
FN3 430 515 2.03e-2 SMART
low complexity region 561 571 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000041142
AA Change: Y605N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041963
Gene: ENSMUSG00000042784
AA Change: Y605N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 30 46 N/A INTRINSIC
internal_repeat_2 48 106 4.93e-6 PROSPERO
internal_repeat_1 79 151 3.46e-38 PROSPERO
low complexity region 153 181 N/A INTRINSIC
internal_repeat_1 183 254 3.46e-38 PROSPERO
internal_repeat_2 192 259 4.93e-6 PROSPERO
low complexity region 277 292 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
low complexity region 382 400 N/A INTRINSIC
SEA 412 528 6.2e-43 SMART
low complexity region 537 552 N/A INTRINSIC
Blast:SEA 557 624 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000090924
SMART Domains Protein: ENSMUSP00000088442
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 20 120 1.92e-6 SMART
BBOX 209 250 9.59e-7 SMART
Blast:BBC 258 382 8e-13 BLAST
FN3 417 502 2.03e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102300
Predicted Effect probably benign
Transcript: ENSMUST00000107464
SMART Domains Protein: ENSMUSP00000103088
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 10 110 1.92e-6 SMART
BBOX 199 240 9.59e-7 SMART
Blast:BBC 248 372 2e-13 BLAST
FN3 407 492 2.03e-2 SMART
low complexity region 538 548 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139419
Predicted Effect probably benign
Transcript: ENSMUST00000143637
SMART Domains Protein: ENSMUSP00000119270
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 270 391 4e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146844
Meta Mutation Damage Score 0.1029 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display delayed mammary tumor progression, impaired intestinal absorption of cholesterol, decreased gastric mucus accumulation, reduced secretion and accumulation of gallbladder mucin, and decreased susceptibility to cholesterol gallstone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,952,184 H1662Q probably damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Adam7 T A 14: 68,527,669 K93M probably damaging Het
Aldh1a2 T G 9: 71,281,706 L301V probably benign Het
Alg9 A G 9: 50,787,572 probably benign Het
Aspg C T 12: 112,116,447 T187I probably damaging Het
C4a A G 17: 34,814,528 noncoding transcript Het
Cdh2 T G 18: 16,627,557 probably benign Het
Ceacam1 T C 7: 25,466,314 probably null Het
Cep250 G A 2: 155,990,681 V1509I probably benign Het
D130043K22Rik T C 13: 24,857,338 S248P probably benign Het
Dgkd A T 1: 87,934,125 M801L probably damaging Het
E330021D16Rik A T 6: 136,401,787 I15N probably damaging Het
Edc4 A G 8: 105,891,264 E1152G possibly damaging Het
Enkd1 A G 8: 105,703,901 I334T probably damaging Het
Gli3 C T 13: 15,723,744 A803V probably benign Het
Glrx3 A G 7: 137,453,414 N95S probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kank2 A T 9: 21,772,760 N724K probably damaging Het
Kctd20 A G 17: 28,966,931 D416G possibly damaging Het
Lmtk3 A G 7: 45,793,828 E645G probably damaging Het
Mrgpra9 A T 7: 47,252,783 probably null Het
Olfr1256 C T 2: 89,835,322 V208M possibly damaging Het
Olfr146 A C 9: 39,019,247 I98R possibly damaging Het
Prx T A 7: 27,518,930 I952N probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Skint5 A T 4: 113,942,659 Y90* probably null Het
Swt1 A T 1: 151,384,391 N752K probably benign Het
Taar1 T C 10: 23,920,533 V43A probably damaging Het
Tenm2 T C 11: 36,041,659 N1702D probably damaging Het
Tff2 C T 17: 31,144,169 probably null Het
Trim2 G A 3: 84,167,677 A686V probably damaging Het
Other mutations in Muc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Muc1 APN 3 89230754 missense probably benign 0.01
IGL01549:Muc1 APN 3 89231810 missense probably damaging 1.00
IGL01969:Muc1 APN 3 89232006 missense probably damaging 1.00
IGL02233:Muc1 APN 3 89231628 missense probably benign 0.11
IGL03160:Muc1 APN 3 89233024 missense possibly damaging 0.89
R0670:Muc1 UTSW 3 89230532 missense probably benign 0.00
R0682:Muc1 UTSW 3 89231132 missense probably damaging 1.00
R0702:Muc1 UTSW 3 89230220 missense probably benign 0.00
R0744:Muc1 UTSW 3 89230328 missense possibly damaging 0.92
R1137:Muc1 UTSW 3 89230438 missense probably benign 0.00
R1673:Muc1 UTSW 3 89231772 missense possibly damaging 0.76
R1869:Muc1 UTSW 3 89231810 missense probably damaging 1.00
R2169:Muc1 UTSW 3 89231596 missense probably damaging 1.00
R4460:Muc1 UTSW 3 89231563 missense probably damaging 0.98
R4461:Muc1 UTSW 3 89231563 missense probably damaging 0.98
R4672:Muc1 UTSW 3 89232077 missense probably damaging 0.99
R5892:Muc1 UTSW 3 89230993 missense probably benign 0.04
R6039:Muc1 UTSW 3 89232029 missense probably damaging 1.00
R6039:Muc1 UTSW 3 89232029 missense probably damaging 1.00
R6931:Muc1 UTSW 3 89229159 unclassified probably benign
R7400:Muc1 UTSW 3 89230646 missense possibly damaging 0.63
R8210:Muc1 UTSW 3 89231599 missense probably damaging 1.00
R8258:Muc1 UTSW 3 89232034 missense probably damaging 1.00
R8259:Muc1 UTSW 3 89232034 missense probably damaging 1.00
R8714:Muc1 UTSW 3 89231514 missense possibly damaging 0.95
R8715:Muc1 UTSW 3 89231514 missense possibly damaging 0.95
R8717:Muc1 UTSW 3 89231514 missense possibly damaging 0.95
R8851:Muc1 UTSW 3 89231118 missense probably benign 0.08
R8854:Muc1 UTSW 3 89232105 missense probably damaging 1.00
R9314:Muc1 UTSW 3 89231518 missense probably damaging 1.00
X0065:Muc1 UTSW 3 89230286 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCCCTTGGTAAATGGAACCCCAC -3'
(R):5'- GGAAACTTCTCTTCCATCAGAGCCC -3'

Sequencing Primer
(F):5'- CATCTTTCCAACCCAGGACA -3'
(R):5'- CTCTGGGCATCCTAATGAGTACAG -3'
Posted On 2014-01-29