Mutagenetix > Incidental Mutations

Incidental Mutation 'R1270:Lmtk3'

151274

Institutional Source

Beutler Lab

Gene Symbol

Lmtk3

Ensembl Gene

ENSMUSG00000062044

Gene Name

lemur tyrosine kinase 3

Synonyms

AATYK3, Aatyk3

MMRRC Submission

039336-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.416) question?

Stock #

R1270 (G1)

Quality Score

126

Status

Validated

Chromosome

Chromosomal Location

45783738-45804144 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 45793828 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 645 (E645G)

Ref Sequence

ENSEMBL: ENSMUSP00000148041 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072580] [ENSMUST00000120005] [ENSMUST00000209617] [ENSMUST00000209701]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000072580
AA Change: E619G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000072388
Gene: ENSMUSG00000062044
AA Change: E619G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
transmembrane domain	39	61	N/A	INTRINSIC
Pfam:Pkinase	133	408	8.3e-37	PFAM
Pfam:Pkinase_Tyr	133	408	4.9e-64	PFAM
low complexity region	415	444	N/A	INTRINSIC
low complexity region	484	506	N/A	INTRINSIC
low complexity region	599	609	N/A	INTRINSIC
low complexity region	639	669	N/A	INTRINSIC
low complexity region	735	791	N/A	INTRINSIC
low complexity region	797	843	N/A	INTRINSIC
low complexity region	1081	1105	N/A	INTRINSIC
low complexity region	1116	1132	N/A	INTRINSIC
low complexity region	1196	1223	N/A	INTRINSIC
low complexity region	1225	1263	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
low complexity region	1384	1393	N/A	INTRINSIC
low complexity region	1407	1421	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000118564
AA Change: E645G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000113323
Gene: ENSMUSG00000062044
AA Change: E645G

Domain	Start	End	E-Value	Type
transmembrane domain	27	49	N/A	INTRINSIC
transmembrane domain	61	83	N/A	INTRINSIC
Pfam:Pkinase_Tyr	159	434	4.2e-64	PFAM
Pfam:Pkinase	159	436	1.3e-33	PFAM
low complexity region	441	470	N/A	INTRINSIC
low complexity region	510	532	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
low complexity region	665	695	N/A	INTRINSIC
low complexity region	761	817	N/A	INTRINSIC
low complexity region	823	869	N/A	INTRINSIC
low complexity region	1107	1131	N/A	INTRINSIC
low complexity region	1142	1158	N/A	INTRINSIC
low complexity region	1222	1249	N/A	INTRINSIC
low complexity region	1251	1289	N/A	INTRINSIC
low complexity region	1371	1388	N/A	INTRINSIC
low complexity region	1410	1419	N/A	INTRINSIC
low complexity region	1433	1447	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120005
AA Change: E619G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112592
Gene: ENSMUSG00000062044
AA Change: E619G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
transmembrane domain	39	61	N/A	INTRINSIC
Pfam:Pkinase	133	408	8.3e-37	PFAM
Pfam:Pkinase_Tyr	133	408	4.9e-64	PFAM
low complexity region	415	444	N/A	INTRINSIC
low complexity region	484	506	N/A	INTRINSIC
low complexity region	599	609	N/A	INTRINSIC
low complexity region	639	669	N/A	INTRINSIC
low complexity region	735	791	N/A	INTRINSIC
low complexity region	797	843	N/A	INTRINSIC
low complexity region	1081	1105	N/A	INTRINSIC
low complexity region	1116	1132	N/A	INTRINSIC
low complexity region	1196	1223	N/A	INTRINSIC
low complexity region	1225	1263	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
low complexity region	1384	1393	N/A	INTRINSIC
low complexity region	1407	1421	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209351

Predicted Effect

probably damaging
Transcript: ENSMUST00000209617
AA Change: E645G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000209701

Predicted Effect

probably benign
Transcript: ENSMUST00000211127

Meta Mutation Damage Score

0.0743

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit pronounced behavioral abnormalities, including locomotor hyperactivity, reduced anxiety, and decreased depression-like behavior, an increased striatal dopamine turnover rate, and enhanced behavioral response to methylphenidate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,952,184	H1662Q	probably damaging	Het
Abcc3	C	T	11: 94,357,384	R1129Q	probably damaging	Het
Adam7	T	A	14: 68,527,669	K93M	probably damaging	Het
Aldh1a2	T	G	9: 71,281,706	L301V	probably benign	Het
Alg9	A	G	9: 50,787,572		probably benign	Het
Aspg	C	T	12: 112,116,447	T187I	probably damaging	Het
C4a	A	G	17: 34,814,528		noncoding transcript	Het
Cdh2	T	G	18: 16,627,557		probably benign	Het
Ceacam1	T	C	7: 25,466,314		probably null	Het
Cep250	G	A	2: 155,990,681	V1509I	probably benign	Het
D130043K22Rik	T	C	13: 24,857,338	S248P	probably benign	Het
Dgkd	A	T	1: 87,934,125	M801L	probably damaging	Het
E330021D16Rik	A	T	6: 136,401,787	I15N	probably damaging	Het
Edc4	A	G	8: 105,891,264	E1152G	possibly damaging	Het
Enkd1	A	G	8: 105,703,901	I334T	probably damaging	Het
Gli3	C	T	13: 15,723,744	A803V	probably benign	Het
Glrx3	A	G	7: 137,453,414	N95S	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kank2	A	T	9: 21,772,760	N724K	probably damaging	Het
Kctd20	A	G	17: 28,966,931	D416G	possibly damaging	Het
Mrgpra9	A	T	7: 47,252,783		probably null	Het
Muc1	T	A	3: 89,232,107	Y605N	probably damaging	Het
Olfr1256	C	T	2: 89,835,322	V208M	possibly damaging	Het
Olfr146	A	C	9: 39,019,247	I98R	possibly damaging	Het
Prx	T	A	7: 27,518,930	I952N	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Skint5	A	T	4: 113,942,659	Y90*	probably null	Het
Swt1	A	T	1: 151,384,391	N752K	probably benign	Het
Taar1	T	C	10: 23,920,533	V43A	probably damaging	Het
Tenm2	T	C	11: 36,041,659	N1702D	probably damaging	Het
Tff2	C	T	17: 31,144,169		probably null	Het
Trim2	G	A	3: 84,167,677	A686V	probably damaging	Het

Other mutations in Lmtk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lmtk3	APN	7	45790907	missense	probably damaging	1.00
IGL01996:Lmtk3	APN	7	45793447	splice site	probably null
IGL02146:Lmtk3	APN	7	45794947	unclassified	probably benign
IGL02192:Lmtk3	APN	7	45794509	unclassified	probably benign
IGL02598:Lmtk3	APN	7	45793140	missense	probably damaging	1.00
BB006:Lmtk3	UTSW	7	45795148	missense	unknown
BB016:Lmtk3	UTSW	7	45795148	missense	unknown
R0469:Lmtk3	UTSW	7	45794112	missense	possibly damaging	0.95
R0510:Lmtk3	UTSW	7	45794112	missense	possibly damaging	0.95
R0603:Lmtk3	UTSW	7	45795556	unclassified	probably benign
R0781:Lmtk3	UTSW	7	45795003	unclassified	probably benign
R1110:Lmtk3	UTSW	7	45795003	unclassified	probably benign
R1535:Lmtk3	UTSW	7	45794570	unclassified	probably benign
R1666:Lmtk3	UTSW	7	45794164	missense	probably benign	0.03
R1807:Lmtk3	UTSW	7	45793278	missense	probably benign	0.02
R1883:Lmtk3	UTSW	7	45786849	missense	probably damaging	1.00
R2060:Lmtk3	UTSW	7	45800911	critical splice acceptor site	probably null
R2107:Lmtk3	UTSW	7	45793969	missense	possibly damaging	0.56
R2214:Lmtk3	UTSW	7	45794853	unclassified	probably benign
R2369:Lmtk3	UTSW	7	45795088	unclassified	probably benign
R4084:Lmtk3	UTSW	7	45793292	missense	probably damaging	0.97
R4246:Lmtk3	UTSW	7	45794062	missense	possibly damaging	0.75
R4247:Lmtk3	UTSW	7	45794062	missense	possibly damaging	0.75
R4249:Lmtk3	UTSW	7	45794062	missense	possibly damaging	0.75
R4250:Lmtk3	UTSW	7	45794062	missense	possibly damaging	0.75
R4587:Lmtk3	UTSW	7	45794080	missense	possibly damaging	0.92
R5026:Lmtk3	UTSW	7	45794412	unclassified	probably benign
R5275:Lmtk3	UTSW	7	45791298	missense	probably damaging	1.00
R5295:Lmtk3	UTSW	7	45791298	missense	probably damaging	1.00
R5624:Lmtk3	UTSW	7	45786862	missense	probably damaging	0.96
R5688:Lmtk3	UTSW	7	45791410	missense	probably damaging	1.00
R6478:Lmtk3	UTSW	7	45798589	missense	unknown
R6737:Lmtk3	UTSW	7	45793627	missense	probably damaging	0.99
R6800:Lmtk3	UTSW	7	45793809	missense	possibly damaging	0.91
R6856:Lmtk3	UTSW	7	45794297	unclassified	probably benign
R7319:Lmtk3	UTSW	7	45794316	missense	unknown
R7335:Lmtk3	UTSW	7	45795157	missense	unknown
R7353:Lmtk3	UTSW	7	45788000	missense	possibly damaging	0.46
R7621:Lmtk3	UTSW	7	45793417	missense	probably damaging	1.00
R7699:Lmtk3	UTSW	7	45792574	missense	probably damaging	1.00
R7700:Lmtk3	UTSW	7	45792574	missense	probably damaging	1.00
R7836:Lmtk3	UTSW	7	45786903	missense	possibly damaging	0.89
R7929:Lmtk3	UTSW	7	45795148	missense	unknown
R7951:Lmtk3	UTSW	7	45785606	missense	probably benign	0.01
R7976:Lmtk3	UTSW	7	45795466	missense	unknown
R8128:Lmtk3	UTSW	7	45794174	missense
R8678:Lmtk3	UTSW	7	45786551	nonsense	probably null
R8732:Lmtk3	UTSW	7	45798288	missense	unknown
R9052:Lmtk3	UTSW	7	45800939	missense	unknown
R9335:Lmtk3	UTSW	7	45792741	missense	probably damaging	1.00
R9356:Lmtk3	UTSW	7	45793888	missense	probably damaging	0.96
R9432:Lmtk3	UTSW	7	45792570	missense	probably damaging	1.00
X0052:Lmtk3	UTSW	7	45793498	missense	probably benign	0.03
X0067:Lmtk3	UTSW	7	45794680	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTATATCCGCCTGGAGGAGCAC -3'
(R):5'- CTGCACGCAAGGAAGAGTCGTC -3'

Sequencing Primer
(F):5'- TTCCCCAACGACTGGGAC -3'
(R):5'- CAAGGAAGAGTCGTCCTCTG -3'

Posted On

2014-01-29