Incidental Mutation 'R1223:Ces3a'
ID152806
Institutional Source Beutler Lab
Gene Symbol Ces3a
Ensembl Gene ENSMUSG00000069922
Gene Namecarboxylesterase 3A
SynonymsEs31, Es-male carboxylesterase
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1223 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105048601-105058413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105058029 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 548 (T548S)
Ref Sequence ENSEMBL: ENSMUSP00000090910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093222] [ENSMUST00000093223]
Predicted Effect probably benign
Transcript: ENSMUST00000093222
AA Change: T548S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000090910
Gene: ENSMUSG00000069922
AA Change: T548S

DomainStartEndE-ValueType
Pfam:COesterase 16 547 1.1e-163 PFAM
Pfam:Abhydrolase_3 147 305 5.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093223
AA Change: T501S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090911
Gene: ENSMUSG00000069922
AA Change: T501S

DomainStartEndE-ValueType
Pfam:COesterase 16 320 1.4e-111 PFAM
Pfam:Abhydrolase_3 147 319 4.8e-14 PFAM
Pfam:COesterase 312 500 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212481
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Ces3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Ces3a APN 8 105050570 missense probably damaging 1.00
IGL01557:Ces3a APN 8 105057751 missense probably damaging 1.00
IGL02092:Ces3a APN 8 105050330 splice site probably benign
IGL02140:Ces3a APN 8 105055631 missense probably benign 0.07
K3955:Ces3a UTSW 8 105050627 splice site probably benign
R0724:Ces3a UTSW 8 105050195 missense possibly damaging 0.73
R1066:Ces3a UTSW 8 105055656 missense probably benign 0.01
R1224:Ces3a UTSW 8 105051509 missense probably damaging 1.00
R1340:Ces3a UTSW 8 105057913 missense probably damaging 1.00
R1513:Ces3a UTSW 8 105050277 missense probably damaging 1.00
R1740:Ces3a UTSW 8 105048685 missense probably damaging 1.00
R2192:Ces3a UTSW 8 105055580 missense probably benign
R3407:Ces3a UTSW 8 105050567 missense probably damaging 1.00
R4002:Ces3a UTSW 8 105057461 missense probably damaging 1.00
R4668:Ces3a UTSW 8 105053423 missense probably damaging 1.00
R5045:Ces3a UTSW 8 105050616 critical splice donor site probably null
R5331:Ces3a UTSW 8 105057556 missense probably damaging 1.00
R5450:Ces3a UTSW 8 105057918 missense possibly damaging 0.83
R5535:Ces3a UTSW 8 105051564 missense probably benign 0.34
R5640:Ces3a UTSW 8 105051745 missense probably benign 0.42
R5881:Ces3a UTSW 8 105050566 missense probably damaging 1.00
R6795:Ces3a UTSW 8 105050596 missense possibly damaging 0.94
R7112:Ces3a UTSW 8 105057962 missense probably damaging 1.00
R7323:Ces3a UTSW 8 105055607 missense possibly damaging 0.54
R7419:Ces3a UTSW 8 105056424 missense probably damaging 1.00
R7793:Ces3a UTSW 8 105055661 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACGCACAGGGTGAGTAGGTTACAC -3'
(R):5'- ACAGCAGCATGGTCCAGGCTAAAG -3'

Sequencing Primer
(F):5'- TACACAGGGCAGGCTTTGG -3'
(R):5'- GGTCCAGGCTAAAGTCTCTGAAC -3'
Posted On2014-01-29