Incidental Mutation 'R1223:Mrgprb1'
ID152799
Institutional Source Beutler Lab
Gene Symbol Mrgprb1
Ensembl Gene ENSMUSG00000070547
Gene NameMAS-related GPR, member B1
SynonymsMrgB1
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1223 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48444113-48456342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48447687 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 159 (V159A)
Ref Sequence ENSEMBL: ENSMUSP00000091946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094384] [ENSMUST00000188095] [ENSMUST00000188918]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094384
AA Change: V159A

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091946
Gene: ENSMUSG00000070547
AA Change: V159A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 227 5.5e-11 PFAM
Pfam:7tm_1 59 290 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188095
Predicted Effect probably benign
Transcript: ENSMUST00000188918
SMART Domains Protein: ENSMUSP00000140432
Gene: ENSMUSG00000070547

DomainStartEndE-ValueType
SCOP:d1l9ha_ 23 84 3e-6 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Mrgprb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Mrgprb1 APN 7 48447543 missense probably damaging 0.99
IGL01141:Mrgprb1 APN 7 48448027 missense probably benign 0.36
IGL01393:Mrgprb1 APN 7 48448006 missense possibly damaging 0.48
IGL02430:Mrgprb1 APN 7 48447661 missense possibly damaging 0.95
IGL02485:Mrgprb1 APN 7 48447717 missense possibly damaging 0.88
R0026:Mrgprb1 UTSW 7 48447204 missense possibly damaging 0.66
R0051:Mrgprb1 UTSW 7 48447214 missense probably benign 0.01
R0789:Mrgprb1 UTSW 7 48456184 splice site probably benign
R1327:Mrgprb1 UTSW 7 48447429 missense possibly damaging 0.87
R1456:Mrgprb1 UTSW 7 48448029 missense probably damaging 0.98
R1561:Mrgprb1 UTSW 7 48447125 unclassified probably null
R1567:Mrgprb1 UTSW 7 48447453 missense probably damaging 0.97
R2030:Mrgprb1 UTSW 7 48447328 missense possibly damaging 0.83
R2165:Mrgprb1 UTSW 7 48447322 missense probably benign 0.00
R2885:Mrgprb1 UTSW 7 48447721 missense probably damaging 1.00
R3108:Mrgprb1 UTSW 7 48447328 missense possibly damaging 0.93
R3919:Mrgprb1 UTSW 7 48448081 missense probably benign 0.03
R4021:Mrgprb1 UTSW 7 48447123 missense possibly damaging 0.95
R4613:Mrgprb1 UTSW 7 48447708 missense possibly damaging 0.91
R4809:Mrgprb1 UTSW 7 48447991 missense possibly damaging 0.89
R5249:Mrgprb1 UTSW 7 48447477 missense possibly damaging 0.91
R5425:Mrgprb1 UTSW 7 48447971 missense possibly damaging 0.81
R5555:Mrgprb1 UTSW 7 48447775 missense probably benign 0.06
R5595:Mrgprb1 UTSW 7 48447684 missense probably damaging 0.99
R5982:Mrgprb1 UTSW 7 48447820 missense probably benign 0.01
R6746:Mrgprb1 UTSW 7 48447897 missense possibly damaging 0.82
R7066:Mrgprb1 UTSW 7 48447676 missense probably benign 0.27
R7141:Mrgprb1 UTSW 7 48447687 missense possibly damaging 0.61
R7633:Mrgprb1 UTSW 7 48447583 missense probably benign 0.01
R8072:Mrgprb1 UTSW 7 48448147 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCATAGGGCAGACCAAAGATCAG -3'
(R):5'- CTTCCAGATGAGCAGGAATGCCTTC -3'

Sequencing Primer
(F):5'- TGGTCACATACAACCTGGTCAC -3'
(R):5'- AACCTTGCTGGTGCTGAC -3'
Posted On2014-01-29