Incidental Mutation 'R5045:Ces3a'
ID394333
Institutional Source Beutler Lab
Gene Symbol Ces3a
Ensembl Gene ENSMUSG00000069922
Gene Namecarboxylesterase 3A
SynonymsEs31, Es-male carboxylesterase
MMRRC Submission 042635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105048601-105058413 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 105050616 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093222] [ENSMUST00000093223]
Predicted Effect probably null
Transcript: ENSMUST00000093222
SMART Domains Protein: ENSMUSP00000090910
Gene: ENSMUSG00000069922

DomainStartEndE-ValueType
Pfam:COesterase 16 547 1.1e-163 PFAM
Pfam:Abhydrolase_3 147 305 5.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093223
SMART Domains Protein: ENSMUSP00000090911
Gene: ENSMUSG00000069922

DomainStartEndE-ValueType
Pfam:COesterase 16 320 1.4e-111 PFAM
Pfam:Abhydrolase_3 147 319 4.8e-14 PFAM
Pfam:COesterase 312 500 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213054
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Ces3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Ces3a APN 8 105050570 missense probably damaging 1.00
IGL01557:Ces3a APN 8 105057751 missense probably damaging 1.00
IGL02092:Ces3a APN 8 105050330 splice site probably benign
IGL02140:Ces3a APN 8 105055631 missense probably benign 0.07
K3955:Ces3a UTSW 8 105050627 splice site probably benign
R0724:Ces3a UTSW 8 105050195 missense possibly damaging 0.73
R1066:Ces3a UTSW 8 105055656 missense probably benign 0.01
R1223:Ces3a UTSW 8 105058029 missense probably benign 0.00
R1224:Ces3a UTSW 8 105051509 missense probably damaging 1.00
R1340:Ces3a UTSW 8 105057913 missense probably damaging 1.00
R1513:Ces3a UTSW 8 105050277 missense probably damaging 1.00
R1740:Ces3a UTSW 8 105048685 missense probably damaging 1.00
R2192:Ces3a UTSW 8 105055580 missense probably benign
R3407:Ces3a UTSW 8 105050567 missense probably damaging 1.00
R4002:Ces3a UTSW 8 105057461 missense probably damaging 1.00
R4668:Ces3a UTSW 8 105053423 missense probably damaging 1.00
R5331:Ces3a UTSW 8 105057556 missense probably damaging 1.00
R5450:Ces3a UTSW 8 105057918 missense possibly damaging 0.83
R5535:Ces3a UTSW 8 105051564 missense probably benign 0.34
R5640:Ces3a UTSW 8 105051745 missense probably benign 0.42
R5881:Ces3a UTSW 8 105050566 missense probably damaging 1.00
R6795:Ces3a UTSW 8 105050596 missense possibly damaging 0.94
R7112:Ces3a UTSW 8 105057962 missense probably damaging 1.00
R7323:Ces3a UTSW 8 105055607 missense possibly damaging 0.54
R7419:Ces3a UTSW 8 105056424 missense probably damaging 1.00
R7793:Ces3a UTSW 8 105055661 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGGGCCACTGATTCAAAG -3'
(R):5'- AGTGTGGATGTCAGGAATCAAC -3'

Sequencing Primer
(F):5'- CAAAGCCATTTCTCTAGGTCATGG -3'
(R):5'- GAACCGGGTCTACTTAGTGC -3'
Posted On2016-06-15