Incidental Mutation 'R1223:Serpinb3a'
ID152784
Institutional Source Beutler Lab
Gene Symbol Serpinb3a
Ensembl Gene ENSMUSG00000044594
Gene Nameserine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3A
SynonymsSqn5
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1223 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location107045587-107052303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107047552 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 175 (N175I)
Ref Sequence ENSEMBL: ENSMUSP00000108337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027567] [ENSMUST00000112717]
Predicted Effect probably damaging
Transcript: ENSMUST00000027567
AA Change: N175I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027567
Gene: ENSMUSG00000044594
AA Change: N175I

DomainStartEndE-ValueType
SERPIN 13 387 6.36e-182 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112717
AA Change: N175I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108337
Gene: ENSMUSG00000044594
AA Change: N175I

DomainStartEndE-ValueType
SERPIN 13 387 6.36e-182 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein is highly expressed in many tumor cells and can inactivate granzyme M, an enzyme that kills tumor cells. This protein, along with serpin B3, can be processed into smaller fragments that aggregate to form an autoantigen in psoriasis, probably by causing chronic inflammation. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to allergen-induced airway hyperresponsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Serpinb3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Serpinb3a APN 1 107051059 nonsense probably null
IGL01940:Serpinb3a APN 1 107046185 missense probably damaging 1.00
IGL02077:Serpinb3a APN 1 107046381 missense probably damaging 0.99
IGL02136:Serpinb3a APN 1 107046285 missense probably benign 0.15
IGL02214:Serpinb3a APN 1 107048488 critical splice donor site probably null
IGL02239:Serpinb3a APN 1 107051688 missense probably benign 0.05
IGL02508:Serpinb3a APN 1 107046072 missense probably damaging 1.00
IGL02533:Serpinb3a APN 1 107047162 missense probably benign 0.00
IGL02860:Serpinb3a APN 1 107049453 splice site probably benign
IGL03013:Serpinb3a APN 1 107046083 missense probably damaging 1.00
IGL03391:Serpinb3a APN 1 107046342 missense possibly damaging 0.81
R0321:Serpinb3a UTSW 1 107047482 nonsense probably null
R0416:Serpinb3a UTSW 1 107049386 missense probably benign 0.29
R0494:Serpinb3a UTSW 1 107047482 nonsense probably null
R0498:Serpinb3a UTSW 1 107047150 missense probably damaging 1.00
R1596:Serpinb3a UTSW 1 107047174 missense probably benign 0.12
R1655:Serpinb3a UTSW 1 107046212 missense probably damaging 1.00
R2156:Serpinb3a UTSW 1 107047472 critical splice donor site probably null
R2296:Serpinb3a UTSW 1 107047561 missense probably damaging 1.00
R4327:Serpinb3a UTSW 1 107051770 start codon destroyed probably damaging 1.00
R4612:Serpinb3a UTSW 1 107047607 missense probably damaging 0.99
R4830:Serpinb3a UTSW 1 107048586 missense probably benign 0.00
R5016:Serpinb3a UTSW 1 107046330 missense probably damaging 1.00
R5483:Serpinb3a UTSW 1 107047169 missense probably benign 0.16
R5619:Serpinb3a UTSW 1 107047108 missense probably damaging 1.00
R7227:Serpinb3a UTSW 1 107051629 missense probably damaging 1.00
R8277:Serpinb3a UTSW 1 107046240 missense probably damaging 1.00
R8526:Serpinb3a UTSW 1 107048774 splice site probably null
Z1177:Serpinb3a UTSW 1 107051008 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGCCTGCACATCCTCCAGAAAC -3'
(R):5'- AGCTCACAAGGCACTTCAAGGAAAG -3'

Sequencing Primer
(F):5'- CTCAGATAGCATTGTTGAGACACC -3'
(R):5'- GCATCATTCATGTAACGATTTGGG -3'
Posted On2014-01-29