Incidental Mutation 'R1366:Frmd6'
ID156046
Institutional Source Beutler Lab
Gene Symbol Frmd6
Ensembl Gene ENSMUSG00000048285
Gene NameFERM domain containing 6
Synonyms
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1366 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location70825514-70902234 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 70887889 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057859]
Predicted Effect probably benign
Transcript: ENSMUST00000057859
SMART Domains Protein: ENSMUSP00000052202
Gene: ENSMUSG00000048285

DomainStartEndE-ValueType
B41 13 234 2.41e-25 SMART
FERM_C 241 332 9.63e-19 SMART
low complexity region 365 375 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
low complexity region 425 442 N/A INTRINSIC
low complexity region 506 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222802
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,517 C205S probably benign Het
Aasdh A T 5: 76,888,804 S297T probably benign Het
Acsm1 T C 7: 119,658,288 probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fam98a A G 17: 75,539,386 probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mkrn1 T C 6: 39,405,917 T134A probably benign Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Msi2 A T 11: 88,716,580 V67D probably damaging Het
Ncapd3 T A 9: 27,057,940 V630E probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Nphp4 T A 4: 152,502,926 D245E probably damaging Het
Olfr1014 G A 2: 85,777,004 C140Y probably benign Het
Olfr114 T C 17: 37,589,764 I196M probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tnfaip2 T G 12: 111,449,322 F485V probably benign Het
Tpd52 T C 3: 8,963,933 D17G probably damaging Het
Ube4b T C 4: 149,335,149 D1034G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in Frmd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0629:Frmd6 UTSW 12 70883762 missense probably damaging 1.00
R0662:Frmd6 UTSW 12 70899444 nonsense probably null
R0747:Frmd6 UTSW 12 70864056 missense probably benign
R1144:Frmd6 UTSW 12 70877168 missense probably damaging 1.00
R1763:Frmd6 UTSW 12 70893622 missense possibly damaging 0.90
R2135:Frmd6 UTSW 12 70894997 missense probably benign 0.00
R2342:Frmd6 UTSW 12 70883818 nonsense probably null
R3963:Frmd6 UTSW 12 70893864 missense probably benign 0.00
R3982:Frmd6 UTSW 12 70887834 missense probably damaging 1.00
R4010:Frmd6 UTSW 12 70899553 missense probably benign
R4416:Frmd6 UTSW 12 70877249 missense probably benign 0.04
R4823:Frmd6 UTSW 12 70872575 missense probably benign 0.22
R4861:Frmd6 UTSW 12 70893726 missense probably damaging 0.98
R5368:Frmd6 UTSW 12 70864100 nonsense probably null
R5806:Frmd6 UTSW 12 70890020 missense probably damaging 1.00
R6226:Frmd6 UTSW 12 70863911 start gained probably benign
R6253:Frmd6 UTSW 12 70877213 missense probably damaging 0.99
R6781:Frmd6 UTSW 12 70899643 missense possibly damaging 0.68
R7051:Frmd6 UTSW 12 70897396 missense possibly damaging 0.78
R7156:Frmd6 UTSW 12 70877209 missense probably damaging 1.00
R7481:Frmd6 UTSW 12 70887055 missense probably damaging 1.00
U24488:Frmd6 UTSW 12 70893879 missense probably damaging 0.97
X0022:Frmd6 UTSW 12 70864108 missense probably damaging 1.00
Z1088:Frmd6 UTSW 12 70880678 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTGACAGTTGCCTTCGGAAGC -3'
(R):5'- AGGGATTCAATCCAGGTTGCCAAG -3'

Sequencing Primer
(F):5'- CCTTTTCCAAAAAAGGGCTGAG -3'
(R):5'- AAGTTTGGCTGCAAGCCC -3'
Posted On2014-02-11