Incidental Mutation 'R1301:Mta2'
ID158393
Institutional Source Beutler Lab
Gene Symbol Mta2
Ensembl Gene ENSMUSG00000071646
Gene Namemetastasis-associated gene family, member 2
SynonymsMta1l1, mmta2
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1301 (G1)
Quality Score178
Status Validated
Chromosome19
Chromosomal Location8941875-8952303 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 8949186 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096239] [ENSMUST00000096240]
Predicted Effect probably benign
Transcript: ENSMUST00000096239
SMART Domains Protein: ENSMUSP00000093958
Gene: ENSMUSG00000071645

DomainStartEndE-ValueType
ZnF_C2H2 16 40 1.53e-1 SMART
RRM 57 124 2.02e-10 SMART
SCOP:d1f5aa2 173 221 1e-3 SMART
low complexity region 242 258 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 324 347 N/A INTRINSIC
low complexity region 423 434 N/A INTRINSIC
Pfam:PAP_assoc 493 552 2.7e-8 PFAM
low complexity region 594 618 N/A INTRINSIC
low complexity region 767 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096240
SMART Domains Protein: ENSMUSP00000093959
Gene: ENSMUSG00000071646

DomainStartEndE-ValueType
BAH 4 144 7.34e-34 SMART
ELM2 147 201 5.58e-15 SMART
SANT 264 313 2.24e-7 SMART
ZnF_GATA 361 415 5.5e-15 SMART
low complexity region 475 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169535
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been identified as a component of NuRD, a nucleosome remodeling deacetylase complex identified in the nucleus of human cells. It shows a very broad expression pattern and is strongly expressed in many tissues. It may represent one member of a small gene family that encode different but related proteins involved either directly or indirectly in transcriptional regulation. Their indirect effects on transcriptional regulation may include chromatin remodeling. It is closely related to another member of this family, a protein that has been correlated with the metastatic potential of certain carcinomas. These two proteins are so closely related that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. One of the proteins known to be a target protein for this gene product is p53. Deacetylation of p53 is correlated with a loss of growth inhibition in transformed cells supporting a connection between these gene family members and metastasis. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit partial embryonic and perinatal lethality, reduced weight, shortened lifespan, and increased susceptibility to systemic lupus erythematosus with increased T cell proliferation under Th2 conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Mta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Mta2 APN 19 8947101 missense probably benign 0.23
IGL01098:Mta2 APN 19 8946717 missense probably damaging 0.98
IGL01148:Mta2 APN 19 8948304 missense probably damaging 0.98
IGL01897:Mta2 APN 19 8947766 nonsense probably null
IGL02054:Mta2 APN 19 8950912 missense probably benign
IGL02157:Mta2 APN 19 8947249 splice site probably benign
IGL02452:Mta2 APN 19 8950306 missense probably benign 0.00
IGL02563:Mta2 APN 19 8948051 missense probably benign
IGL02626:Mta2 APN 19 8949168 missense probably damaging 1.00
IGL02695:Mta2 APN 19 8948364 missense probably benign 0.01
R1208:Mta2 UTSW 19 8951017 missense probably damaging 1.00
R1208:Mta2 UTSW 19 8951017 missense probably damaging 1.00
R1731:Mta2 UTSW 19 8947724 splice site probably null
R1990:Mta2 UTSW 19 8942332 unclassified probably benign
R2116:Mta2 UTSW 19 8943516 missense probably damaging 1.00
R2117:Mta2 UTSW 19 8943516 missense probably damaging 1.00
R4614:Mta2 UTSW 19 8948128 splice site probably null
R4710:Mta2 UTSW 19 8949153 missense probably damaging 1.00
R4801:Mta2 UTSW 19 8945851 missense probably damaging 1.00
R4802:Mta2 UTSW 19 8945851 missense probably damaging 1.00
R4947:Mta2 UTSW 19 8946291 missense possibly damaging 0.68
R4999:Mta2 UTSW 19 8950383 missense probably benign
R5340:Mta2 UTSW 19 8942356 start codon destroyed probably null 0.89
R5518:Mta2 UTSW 19 8948092 missense probably benign 0.01
R6044:Mta2 UTSW 19 8948331 missense probably damaging 0.99
R7096:Mta2 UTSW 19 8947775 missense probably damaging 1.00
R7604:Mta2 UTSW 19 8945836 missense probably damaging 1.00
R7919:Mta2 UTSW 19 8949134 nonsense probably null
R7992:Mta2 UTSW 19 8947787 critical splice donor site probably null
R8198:Mta2 UTSW 19 8947781 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GTTGCTGGCTAAGAACAGGCAAAC -3'
(R):5'- AAGGGGAAGCCTCTAGGCACTC -3'

Sequencing Primer
(F):5'- GAACAGGCAAACTTTCTTGCTC -3'
(R):5'- cctgactccacccctcc -3'
Posted On2014-02-18