Incidental Mutation 'R1301:Grm8'
ID158362
Institutional Source Beutler Lab
Gene Symbol Grm8
Ensembl Gene ENSMUSG00000024211
Gene Nameglutamate receptor, metabotropic 8
SynonymsmGluR8, Gprc1h
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1301 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location27275119-28135178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 27981201 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 237 (Q237K)
Ref Sequence ENSEMBL: ENSMUSP00000120394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324] [ENSMUST00000131897]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090512
AA Change: Q237K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: Q237K

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 9.6e-102 PFAM
Pfam:Peripla_BP_6 141 375 1.3e-9 PFAM
Pfam:NCD3G 512 562 5e-17 PFAM
Pfam:7tm_3 593 841 4.7e-88 PFAM
low complexity region 887 905 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115323
AA Change: Q237K

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: Q237K

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 3.3e-107 PFAM
Pfam:NCD3G 512 562 9e-14 PFAM
Pfam:7tm_3 595 840 6.8e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115324
AA Change: Q237K

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: Q237K

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 2.1e-101 PFAM
Pfam:Peripla_BP_6 141 375 9.2e-10 PFAM
Pfam:NCD3G 512 562 2.8e-16 PFAM
Pfam:7tm_3 593 841 2.4e-87 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131897
AA Change: Q237K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120394
Gene: ENSMUSG00000024211
AA Change: Q237K

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 294 5.8e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146727
Meta Mutation Damage Score 0.1133 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Grm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Grm8 APN 6 27363801 missense probably damaging 1.00
IGL01412:Grm8 APN 6 27762461 missense probably damaging 1.00
IGL02329:Grm8 APN 6 27363116 missense probably damaging 1.00
IGL02342:Grm8 APN 6 27363804 missense probably benign 0.00
IGL02584:Grm8 APN 6 27762439 missense probably benign 0.35
IGL03040:Grm8 APN 6 28126123 start codon destroyed probably null 0.01
IGL03112:Grm8 APN 6 27363263 missense probably damaging 1.00
IGL03139:Grm8 APN 6 27618650 missense probably damaging 1.00
IGL03287:Grm8 APN 6 27760255 missense possibly damaging 0.86
R0137:Grm8 UTSW 6 27762390 missense probably damaging 0.99
R0266:Grm8 UTSW 6 27285896 missense probably damaging 1.00
R0347:Grm8 UTSW 6 27981222 missense probably benign 0.37
R0580:Grm8 UTSW 6 27761371 splice site probably benign
R0698:Grm8 UTSW 6 27363914 missense probably damaging 1.00
R0833:Grm8 UTSW 6 27363179 missense probably damaging 1.00
R1323:Grm8 UTSW 6 28125974 missense probably damaging 1.00
R1323:Grm8 UTSW 6 28125974 missense probably damaging 1.00
R1471:Grm8 UTSW 6 27363309 missense possibly damaging 0.79
R1554:Grm8 UTSW 6 28125853 missense probably benign 0.01
R1638:Grm8 UTSW 6 28125883 nonsense probably null
R1763:Grm8 UTSW 6 27285867 missense possibly damaging 0.79
R1899:Grm8 UTSW 6 28125895 missense probably damaging 1.00
R1902:Grm8 UTSW 6 27429482 missense probably damaging 1.00
R1916:Grm8 UTSW 6 27363584 missense probably benign 0.01
R2257:Grm8 UTSW 6 27760225 missense probably damaging 0.98
R2351:Grm8 UTSW 6 28126119 missense possibly damaging 0.66
R2396:Grm8 UTSW 6 27761242 missense probably damaging 0.98
R3801:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3802:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3803:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3804:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3830:Grm8 UTSW 6 27761229 nonsense probably null
R3844:Grm8 UTSW 6 27429508 missense possibly damaging 0.69
R4006:Grm8 UTSW 6 27981230 missense probably damaging 1.00
R4077:Grm8 UTSW 6 27760209 missense probably benign 0.01
R4395:Grm8 UTSW 6 27429432 missense probably damaging 0.98
R4436:Grm8 UTSW 6 27761238 missense possibly damaging 0.48
R4810:Grm8 UTSW 6 27761296 missense possibly damaging 0.87
R5357:Grm8 UTSW 6 27762419 missense probably damaging 1.00
R5677:Grm8 UTSW 6 27761204 critical splice donor site probably null
R5983:Grm8 UTSW 6 27760221 missense probably benign 0.03
R5990:Grm8 UTSW 6 27363624 missense probably damaging 1.00
R6365:Grm8 UTSW 6 27363227 missense probably damaging 1.00
R6454:Grm8 UTSW 6 27363776 missense possibly damaging 0.68
R6713:Grm8 UTSW 6 27363191 missense probably damaging 1.00
R6960:Grm8 UTSW 6 27981282 missense probably damaging 0.98
R7194:Grm8 UTSW 6 27618487 missense probably benign 0.01
R7259:Grm8 UTSW 6 27760176 missense probably null 0.99
R7305:Grm8 UTSW 6 27761355 missense possibly damaging 0.51
R7421:Grm8 UTSW 6 27762477 missense possibly damaging 0.66
R7561:Grm8 UTSW 6 27429525 missense probably benign 0.44
R7605:Grm8 UTSW 6 27618679 missense probably damaging 1.00
R7651:Grm8 UTSW 6 27760258 missense possibly damaging 0.46
R7775:Grm8 UTSW 6 27363672 missense possibly damaging 0.89
R7778:Grm8 UTSW 6 27363672 missense possibly damaging 0.89
R7781:Grm8 UTSW 6 27285787 missense probably benign
R7785:Grm8 UTSW 6 27618637 missense probably damaging 0.99
R7898:Grm8 UTSW 6 27762423 missense probably damaging 1.00
R8272:Grm8 UTSW 6 27363282 missense probably damaging 1.00
R8274:Grm8 UTSW 6 27761336 missense probably benign 0.31
R8501:Grm8 UTSW 6 27618541 missense probably damaging 0.98
RF013:Grm8 UTSW 6 27363780 missense probably damaging 1.00
Z1176:Grm8 UTSW 6 28126027 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AAGCACTGATCCCTCTAGTGTCCC -3'
(R):5'- TCTACAGCCCCAGAGCTAAGTGAC -3'

Sequencing Primer
(F):5'- CAAATTCACTGTGGCTCTAAGG -3'
(R):5'- GTGACAACACCAGGTATGATTTC -3'
Posted On2014-02-18