Mutagenetix > Incidental Mutation

Incidental Mutation 'R1301:Grm8'

158362

Institutional Source

Beutler Lab

Gene Symbol

Grm8

Ensembl Gene

ENSMUSG00000024211

Gene Name

glutamate receptor, metabotropic 8

Synonyms

mGluR8, Gprc1h

MMRRC Submission

039367-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1301 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27275119-28135178 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 27981201 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 237 (Q237K)

Ref Sequence

ENSEMBL: ENSMUSP00000120394 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324] [ENSMUST00000131897]

AlphaFold

P47743

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090512
AA Change: Q237K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: Q237K

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	9.6e-102	PFAM
Pfam:Peripla_BP_6	141	375	1.3e-9	PFAM
Pfam:NCD3G	512	562	5e-17	PFAM
Pfam:7tm_3	593	841	4.7e-88	PFAM
low complexity region	887	905	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115323
AA Change: Q237K

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: Q237K

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	3.3e-107	PFAM
Pfam:NCD3G	512	562	9e-14	PFAM
Pfam:7tm_3	595	840	6.8e-58	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115324
AA Change: Q237K

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: Q237K

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	2.1e-101	PFAM
Pfam:Peripla_BP_6	141	375	9.2e-10	PFAM
Pfam:NCD3G	512	562	2.8e-16	PFAM
Pfam:7tm_3	593	841	2.4e-87	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131897
AA Change: Q237K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000120394
Gene: ENSMUSG00000024211
AA Change: Q237K

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	294	5.8e-66	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146727

Meta Mutation Damage Score

0.1133

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.3%
20x: 82.6%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano1	A	G	7: 144,633,689	W447R	possibly damaging	Het
Blm	T	A	7: 80,455,417	K103*	probably null	Het
Camta2	A	G	11: 70,676,404	I675T	probably benign	Het
Catsperz	G	A	19: 6,925,082	R15C	probably damaging	Het
Chd1l	T	C	3: 97,603,648		probably benign	Het
Corin	C	A	5: 72,304,933	E844D	possibly damaging	Het
Cyb5rl	T	G	4: 107,080,907	M127R	probably damaging	Het
Dcdc2a	A	T	13: 25,102,586	N164I	possibly damaging	Het
Dnah6	A	G	6: 73,208,545		probably null	Het
Emilin2	T	C	17: 71,255,965		probably benign	Het
Epb41l2	T	A	10: 25,443,902	V211D	probably damaging	Het
Fbxo47	C	T	11: 97,868,601	M166I	probably benign	Het
Gm13124	T	A	4: 144,565,065	I24L	probably benign	Het
Gm4450	G	A	3: 98,446,866	Q106*	probably null	Het
Golm1	T	C	13: 59,638,373	D335G	probably damaging	Het
Gpn1	T	A	5: 31,503,429	M188K	probably damaging	Het
Gpr84	T	A	15: 103,309,219	S144C	probably damaging	Het
Gsdmd	C	A	15: 75,867,059		probably null	Het
Hmgcr	G	A	13: 96,659,020	T347I	probably damaging	Het
Hsd17b7	T	A	1: 169,961,205		probably benign	Het
Klhl7	T	G	5: 24,159,491	W508G	probably damaging	Het
Lrp2	C	A	2: 69,428,604	D4581Y	probably damaging	Het
Lrrc7	T	C	3: 158,135,331	N1357D	probably benign	Het
Macf1	T	C	4: 123,486,658		probably benign	Het
Mroh7	T	C	4: 106,720,495	T329A	probably damaging	Het
Mroh9	C	T	1: 163,043,983		probably null	Het
Mta2	A	G	19: 8,949,186		probably benign	Het
Myo3a	A	T	2: 22,267,095		probably benign	Het
Nrip2	A	G	6: 128,407,389	D153G	probably benign	Het
Nup133	T	C	8: 123,917,417		probably benign	Het
Nup210	C	T	6: 91,042,347	V259M	possibly damaging	Het
Olfr1338	C	T	4: 118,753,619	M308I	probably benign	Het
Olfr1466	A	T	19: 13,341,847	I30F	probably benign	Het
Olfr1499	A	T	19: 13,815,362	V76D	probably damaging	Het
Otog	C	T	7: 46,289,689	R2048C	probably damaging	Het
Paqr7	T	C	4: 134,507,813	L327P	probably damaging	Het
Parl	A	G	16: 20,286,926	S249P	probably damaging	Het
Phc1	A	G	6: 122,325,874	I230T	probably benign	Het
Pitpnm1	T	G	19: 4,110,831		probably null	Het
Plpp1	A	G	13: 112,834,943	Y48C	probably damaging	Het
Pxdc1	A	G	13: 34,628,887	F194L	probably benign	Het
Rp1	A	T	1: 4,345,936	V1651D	possibly damaging	Het
Serpinb1c	T	A	13: 32,896,960	R47*	probably null	Het
Sis	T	C	3: 72,946,582	T521A	possibly damaging	Het
Slc16a9	A	G	10: 70,282,478	D209G	probably benign	Het
Slc26a4	A	T	12: 31,525,568	C706*	probably null	Het
Slc37a2	A	G	9: 37,236,881	V325A	probably benign	Het
Speg	T	A	1: 75,401,501	D784E	probably damaging	Het
Sycp1	T	C	3: 102,920,622	I270V	probably benign	Het
Tatdn2	T	A	6: 113,704,115	F309I	probably damaging	Het
Tmem206	T	C	1: 191,348,435	V284A	probably damaging	Het
Tmem67	T	C	4: 12,089,400		probably benign	Het
Trpm1	T	A	7: 64,203,053		probably null	Het
Wrn	T	C	8: 33,292,686	R496G	probably damaging	Het
Zfhx2	A	G	14: 55,063,397	V2299A	probably benign	Het
Zfp819	T	A	7: 43,617,100	S260T	possibly damaging	Het

Other mutations in Grm8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Grm8	APN	6	27363801	missense	probably damaging	1.00
IGL01412:Grm8	APN	6	27762461	missense	probably damaging	1.00
IGL02329:Grm8	APN	6	27363116	missense	probably damaging	1.00
IGL02342:Grm8	APN	6	27363804	missense	probably benign	0.00
IGL02584:Grm8	APN	6	27762439	missense	probably benign	0.35
IGL03040:Grm8	APN	6	28126123	start codon destroyed	probably null	0.01
IGL03112:Grm8	APN	6	27363263	missense	probably damaging	1.00
IGL03139:Grm8	APN	6	27618650	missense	probably damaging	1.00
IGL03287:Grm8	APN	6	27760255	missense	possibly damaging	0.86
R0137:Grm8	UTSW	6	27762390	missense	probably damaging	0.99
R0266:Grm8	UTSW	6	27285896	missense	probably damaging	1.00
R0347:Grm8	UTSW	6	27981222	missense	probably benign	0.37
R0580:Grm8	UTSW	6	27761371	splice site	probably benign
R0698:Grm8	UTSW	6	27363914	missense	probably damaging	1.00
R0833:Grm8	UTSW	6	27363179	missense	probably damaging	1.00
R1323:Grm8	UTSW	6	28125974	missense	probably damaging	1.00
R1323:Grm8	UTSW	6	28125974	missense	probably damaging	1.00
R1471:Grm8	UTSW	6	27363309	missense	possibly damaging	0.79
R1554:Grm8	UTSW	6	28125853	missense	probably benign	0.01
R1638:Grm8	UTSW	6	28125883	nonsense	probably null
R1763:Grm8	UTSW	6	27285867	missense	possibly damaging	0.79
R1899:Grm8	UTSW	6	28125895	missense	probably damaging	1.00
R1902:Grm8	UTSW	6	27429482	missense	probably damaging	1.00
R1916:Grm8	UTSW	6	27363584	missense	probably benign	0.01
R2257:Grm8	UTSW	6	27760225	missense	probably damaging	0.98
R2351:Grm8	UTSW	6	28126119	missense	possibly damaging	0.66
R2396:Grm8	UTSW	6	27761242	missense	probably damaging	0.98
R3801:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3802:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3803:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3804:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3830:Grm8	UTSW	6	27761229	nonsense	probably null
R3844:Grm8	UTSW	6	27429508	missense	possibly damaging	0.69
R4006:Grm8	UTSW	6	27981230	missense	probably damaging	1.00
R4077:Grm8	UTSW	6	27760209	missense	probably benign	0.01
R4395:Grm8	UTSW	6	27429432	missense	probably damaging	0.98
R4436:Grm8	UTSW	6	27761238	missense	possibly damaging	0.48
R4810:Grm8	UTSW	6	27761296	missense	possibly damaging	0.87
R5357:Grm8	UTSW	6	27762419	missense	probably damaging	1.00
R5677:Grm8	UTSW	6	27761204	critical splice donor site	probably null
R5983:Grm8	UTSW	6	27760221	missense	probably benign	0.03
R5990:Grm8	UTSW	6	27363624	missense	probably damaging	1.00
R6365:Grm8	UTSW	6	27363227	missense	probably damaging	1.00
R6454:Grm8	UTSW	6	27363776	missense	possibly damaging	0.68
R6713:Grm8	UTSW	6	27363191	missense	probably damaging	1.00
R6960:Grm8	UTSW	6	27981282	missense	probably damaging	0.98
R7194:Grm8	UTSW	6	27618487	missense	probably benign	0.01
R7259:Grm8	UTSW	6	27760176	missense	probably null	0.99
R7305:Grm8	UTSW	6	27761355	missense	possibly damaging	0.51
R7421:Grm8	UTSW	6	27762477	missense	possibly damaging	0.66
R7561:Grm8	UTSW	6	27429525	missense	probably benign	0.44
R7605:Grm8	UTSW	6	27618679	missense	probably damaging	1.00
R7651:Grm8	UTSW	6	27760258	missense	possibly damaging	0.46
R7775:Grm8	UTSW	6	27363672	missense	possibly damaging	0.89
R7778:Grm8	UTSW	6	27363672	missense	possibly damaging	0.89
R7781:Grm8	UTSW	6	27285787	missense	probably benign
R7785:Grm8	UTSW	6	27618637	missense	probably damaging	0.99
R7898:Grm8	UTSW	6	27762423	missense	probably damaging	1.00
R8272:Grm8	UTSW	6	27363282	missense	probably damaging	1.00
R8274:Grm8	UTSW	6	27761336	missense	probably benign	0.31
R8501:Grm8	UTSW	6	27618541	missense	probably damaging	0.98
R8695:Grm8	UTSW	6	28126031	missense	probably benign	0.01
R8824:Grm8	UTSW	6	27761352	missense	probably damaging	1.00
R8869:Grm8	UTSW	6	27363753	missense	probably benign	0.26
R9322:Grm8	UTSW	6	27363729	missense	possibly damaging	0.88
R9337:Grm8	UTSW	6	27761215	missense	probably benign	0.01
R9518:Grm8	UTSW	6	27429470	missense	probably benign	0.01
RF013:Grm8	UTSW	6	27363780	missense	probably damaging	1.00
Z1176:Grm8	UTSW	6	28126027	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- AAGCACTGATCCCTCTAGTGTCCC -3'
(R):5'- TCTACAGCCCCAGAGCTAAGTGAC -3'

Sequencing Primer
(F):5'- CAAATTCACTGTGGCTCTAAGG -3'
(R):5'- GTGACAACACCAGGTATGATTTC -3'

Posted On

2014-02-18