Incidental Mutation 'R1301:Gm4450'
ID158349
Institutional Source Beutler Lab
Gene Symbol Gm4450
Ensembl Gene ENSMUSG00000090817
Gene Namepredicted gene 4450
Synonyms
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1301 (G1)
Quality Score162
Status Not validated
Chromosome3
Chromosomal Location98445675-98457126 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 98446866 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 106 (Q106*)
Ref Sequence ENSEMBL: ENSMUSP00000139967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167753] [ENSMUST00000188356]
Predicted Effect probably null
Transcript: ENSMUST00000167753
AA Change: Q106*
SMART Domains Protein: ENSMUSP00000127882
Gene: ENSMUSG00000090817
AA Change: Q106*

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 260 2.4e-9 PFAM
Pfam:KR 5 133 4.7e-8 PFAM
Pfam:Polysacc_synt_2 6 135 1.2e-12 PFAM
Pfam:NmrA 6 147 2.8e-12 PFAM
Pfam:Epimerase 6 249 2.7e-24 PFAM
Pfam:GDP_Man_Dehyd 7 218 8.6e-13 PFAM
Pfam:3Beta_HSD 7 288 2.4e-106 PFAM
Pfam:NAD_binding_4 8 225 5.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187850
Predicted Effect probably null
Transcript: ENSMUST00000188356
AA Change: Q106*
SMART Domains Protein: ENSMUSP00000139967
Gene: ENSMUSG00000090817
AA Change: Q106*

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 175 1.8e-6 PFAM
Pfam:adh_short 5 133 1.3e-8 PFAM
Pfam:KR 5 133 5.6e-8 PFAM
Pfam:Polysacc_synt_2 6 137 3.1e-11 PFAM
Pfam:NmrA 6 147 2.1e-10 PFAM
Pfam:NAD_binding_10 6 175 4e-12 PFAM
Pfam:Epimerase 6 191 1.6e-22 PFAM
Pfam:3Beta_HSD 7 191 1e-71 PFAM
Pfam:NAD_binding_4 8 191 4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196741
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Gm4450
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Gm4450 APN 3 98456400 missense probably benign
IGL02004:Gm4450 APN 3 98456419 missense probably damaging 1.00
R0688:Gm4450 UTSW 3 98456394 missense probably benign 0.19
R2926:Gm4450 UTSW 3 98450556 splice site probably benign
R4797:Gm4450 UTSW 3 98456431 nonsense probably null
R4915:Gm4450 UTSW 3 98450529 missense probably damaging 0.97
R5796:Gm4450 UTSW 3 98446852 missense probably benign 0.00
R6479:Gm4450 UTSW 3 98446841 missense possibly damaging 0.79
R7085:Gm4450 UTSW 3 98450394 missense probably damaging 1.00
R8417:Gm4450 UTSW 3 98456415 missense probably benign 0.08
Z1176:Gm4450 UTSW 3 98456455 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGCACTGCCTTCTCAGCC -3'
(R):5'- CCCTCATTTCCAGAATCTACATGTCACC -3'

Sequencing Primer
(F):5'- CAGCCATCTTTTTGCTGTATGGG -3'
(R):5'- GTCACCTCCATTAATTTCAGAGTG -3'
Posted On2014-02-18