Mutagenetix > Incidental Mutation

Incidental Mutation 'R1413:Hook3'

159701

Institutional Source

Beutler Lab

Gene Symbol

Hook3

Ensembl Gene

ENSMUSG00000037234

Gene Name

hook microtubule tethering protein 3

Synonyms

E330005F07Rik, 5830454D03Rik

MMRRC Submission

039469-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1413 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26021421-26119224 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 26038106 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 585 (E585D)

Ref Sequence

ENSEMBL: ENSMUSP00000046788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]

AlphaFold

Q8BUK6

Predicted Effect

probably damaging
Transcript: ENSMUST00000037182
AA Change: E585D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: E585D

Domain	Start	End	E-Value	Type
Pfam:HOOK	12	710	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147613
AA Change: E225D

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234
AA Change: E225D

Domain	Start	End	E-Value	Type
Pfam:HOOK	1	194	1.1e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152144

Predicted Effect

probably benign
Transcript: ENSMUST00000211683

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211777

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	T	C	6: 142,627,519	N1051D	possibly damaging	Het
Abcc9	A	G	6: 142,590,496	V1504A	probably damaging	Het
Actr6	A	T	10: 89,728,157	Y84*	probably null	Het
Adgrl3	T	C	5: 81,693,519	Y816H	probably damaging	Het
Ahcyl2	T	C	6: 29,768,587		probably benign	Het
Amd1	A	T	10: 40,290,408	C157*	probably null	Het
Ank1	G	A	8: 23,119,377	E1362K	probably damaging	Het
Atp10b	A	G	11: 43,230,564	Q1018R	probably benign	Het
Atp1a2	G	A	1: 172,279,344	T803I	probably damaging	Het
Atr	T	G	9: 95,932,442	L2064R	probably damaging	Het
Bmp3	T	A	5: 98,872,405	L229Q	probably damaging	Het
Ccl25	A	G	8: 4,353,892	*54W	probably null	Het
Cdc45	A	T	16: 18,808,741	N111K	possibly damaging	Het
Cfap61	T	A	2: 145,963,443	S154T	probably benign	Het
Cyp2c37	T	A	19: 39,994,098	S127T	probably benign	Het
Cyp4f40	T	A	17: 32,673,939	D309E	probably benign	Het
D6Ertd527e	A	G	6: 87,111,353	D166G	unknown	Het
Dmbt1	T	A	7: 131,050,214	D395E	probably damaging	Het
Dnah5	A	G	15: 28,370,409	S2832G	probably benign	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Fah	T	C	7: 84,593,212	D296G	probably damaging	Het
Fam83g	A	G	11: 61,702,678	N346S	probably damaging	Het
Fgl1	T	A	8: 41,191,601	T289S	possibly damaging	Het
Fmo1	A	C	1: 162,833,862	L284R	probably damaging	Het
Frem3	T	A	8: 80,668,801	M1819K	probably benign	Het
Fsip2	T	A	2: 82,988,418	L4832M	possibly damaging	Het
Fut1	T	C	7: 45,619,428	W269R	probably damaging	Het
Ggnbp2	A	G	11: 84,833,129	Y638H	probably damaging	Het
Gp2	T	A	7: 119,451,630	I293F	probably benign	Het
Gpi1	T	C	7: 34,230,155	N20S	probably benign	Het
Gxylt1	C	T	15: 93,254,392	R222H	probably damaging	Het
Hemgn	T	C	4: 46,396,091	K382E	possibly damaging	Het
Irf6	G	A	1: 193,169,305	M401I	probably benign	Het
Jmjd1c	A	G	10: 67,249,750	T2259A	probably damaging	Het
Lactb	T	A	9: 66,970,919	R209S	probably damaging	Het
Lonp2	A	G	8: 86,641,584	D342G	probably damaging	Het
Mmachc	T	C	4: 116,705,997	S54G	probably damaging	Het
Mpp7	C	A	18: 7,350,977	W573C	probably damaging	Het
Olfr1133	T	A	2: 87,645,838	Y95F	probably benign	Het
Olfr1415	A	T	1: 92,490,888	I289N	probably damaging	Het
Olfr70	T	A	4: 43,697,011	H54L	possibly damaging	Het
Pappa2	A	T	1: 158,936,554	D462E	probably benign	Het
Pcdh12	A	T	18: 38,283,443	F210I	probably damaging	Het
Ppp1r12c	A	G	7: 4,484,444		probably null	Het
Prkce	T	A	17: 86,496,018	D448E	possibly damaging	Het
Ptprb	C	A	10: 116,339,679	T1193K	probably damaging	Het
Qrfpr	T	A	3: 36,182,660	E197D	possibly damaging	Het
Rusc2	T	A	4: 43,416,568	C625S	probably benign	Het
Shcbp1	T	G	8: 4,741,968		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spag5	T	A	11: 78,305,317	C449*	probably null	Het
Stpg3	T	C	2: 25,213,850	D158G	probably damaging	Het
Sycp2	T	C	2: 178,347,797	Y1423C	probably benign	Het
Tiprl	C	T	1: 165,215,790	E256K	possibly damaging	Het
Tmem132c	T	A	5: 127,563,567	V934D	probably damaging	Het
Topors	A	G	4: 40,261,982	V434A	probably benign	Het
Usp11	A	G	X: 20,718,707	Y731C	probably damaging	Het
Vmn2r58	T	A	7: 41,863,963	I419L	probably benign	Het
Wfs1	C	A	5: 36,982,078	R72L	possibly damaging	Het
Zan	T	C	5: 137,427,939	D2525G	unknown	Het
Zfp280c	A	G	X: 48,563,838	V285A	probably benign	Het
Zfp511	T	A	7: 140,037,615	F177I	probably damaging	Het
Zfp964	A	G	8: 69,663,070	M107V	unknown	Het
Zmynd11	A	G	13: 9,710,220	Y122H	probably damaging	Het

Other mutations in Hook3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00695:Hook3	APN	8	26059250	missense	possibly damaging	0.46
IGL01066:Hook3	APN	8	26048298	missense	probably damaging	1.00
IGL01145:Hook3	APN	8	26059344	missense	probably benign	0.00
IGL01514:Hook3	APN	8	26088189	missense	possibly damaging	0.69
IGL01727:Hook3	APN	8	26070159	missense	probably benign	0.00
IGL01832:Hook3	APN	8	26072365	missense	possibly damaging	0.87
IGL01874:Hook3	APN	8	26039732	missense	possibly damaging	0.71
IGL01931:Hook3	APN	8	26088055	splice site	probably benign
IGL01948:Hook3	APN	8	26059312	missense	possibly damaging	0.95
IGL02209:Hook3	APN	8	26070265	missense	probably damaging	0.99
IGL02675:Hook3	APN	8	26061434	missense	possibly damaging	0.64
IGL02750:Hook3	APN	8	26095754	splice site	probably benign
Rufio	UTSW	8	26034940	nonsense	probably null
R0384:Hook3	UTSW	8	26044235	splice site	probably null
R0600:Hook3	UTSW	8	26118986	missense	probably benign
R1037:Hook3	UTSW	8	26072350	missense	possibly damaging	0.92
R1563:Hook3	UTSW	8	26110752	missense	probably benign	0.06
R1767:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R1806:Hook3	UTSW	8	26068659	missense	probably damaging	1.00
R2025:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2026:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2027:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2091:Hook3	UTSW	8	26059394	splice site	probably benign
R2153:Hook3	UTSW	8	26070197	missense	probably damaging	1.00
R2184:Hook3	UTSW	8	26118983	missense	probably benign	0.00
R4586:Hook3	UTSW	8	26032011	missense	probably damaging	0.98
R4863:Hook3	UTSW	8	26038029	missense	probably damaging	1.00
R4971:Hook3	UTSW	8	26082579	missense	probably benign	0.22
R5023:Hook3	UTSW	8	26032019	frame shift	probably null
R5026:Hook3	UTSW	8	26110757	missense	probably damaging	0.98
R5068:Hook3	UTSW	8	26095757	critical splice donor site	probably null
R5253:Hook3	UTSW	8	26072291	missense	probably benign
R5383:Hook3	UTSW	8	26118989	missense	probably benign	0.01
R5437:Hook3	UTSW	8	26061422	missense	probably benign	0.05
R5528:Hook3	UTSW	8	26072293	missense	probably damaging	1.00
R5551:Hook3	UTSW	8	26068611	missense	possibly damaging	0.75
R5846:Hook3	UTSW	8	26044327	intron	probably benign
R5907:Hook3	UTSW	8	26044278	intron	probably benign
R6082:Hook3	UTSW	8	26110785	missense	probably benign	0.00
R6124:Hook3	UTSW	8	26059272	missense	probably benign	0.20
R6301:Hook3	UTSW	8	26034940	nonsense	probably null
R6314:Hook3	UTSW	8	26088108	missense	probably benign
R6448:Hook3	UTSW	8	26093664	missense	probably benign	0.02
R6810:Hook3	UTSW	8	26032422	splice site	probably null
R7168:Hook3	UTSW	8	26071086	missense	probably benign	0.02
R7856:Hook3	UTSW	8	26035221	missense	probably damaging	1.00
R7988:Hook3	UTSW	8	26073647	missense	probably benign	0.02
R8079:Hook3	UTSW	8	26088058	critical splice donor site	probably null
R9121:Hook3	UTSW	8	26035167	missense	probably damaging	1.00
R9223:Hook3	UTSW	8	26032524	missense
R9244:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R9246:Hook3	UTSW	8	26072291	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATACTTCCAGGCTAGAGGACAGCATCG -3'
(R):5'- TGAGCCTCACACTGCCCACC -3'

Sequencing Primer
(F):5'- AGGACAGCATCGCTGGG -3'
(R):5'- acaaccatccgtaacaagacc -3'

Posted On

2014-03-14