Incidental Mutation 'R1413:Hook3'
ID 159701
Institutional Source Beutler Lab
Gene Symbol Hook3
Ensembl Gene ENSMUSG00000037234
Gene Name hook microtubule tethering protein 3
Synonyms E330005F07Rik, 5830454D03Rik
MMRRC Submission 039469-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1413 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 26021421-26119224 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26038106 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 585 (E585D)
Ref Sequence ENSEMBL: ENSMUSP00000046788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]
AlphaFold Q8BUK6
Predicted Effect probably damaging
Transcript: ENSMUST00000037182
AA Change: E585D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: E585D

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147613
AA Change: E225D

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234
AA Change: E225D

DomainStartEndE-ValueType
Pfam:HOOK 1 194 1.1e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152144
Predicted Effect probably benign
Transcript: ENSMUST00000211683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211777
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,627,519 N1051D possibly damaging Het
Abcc9 A G 6: 142,590,496 V1504A probably damaging Het
Actr6 A T 10: 89,728,157 Y84* probably null Het
Adgrl3 T C 5: 81,693,519 Y816H probably damaging Het
Ahcyl2 T C 6: 29,768,587 probably benign Het
Amd1 A T 10: 40,290,408 C157* probably null Het
Ank1 G A 8: 23,119,377 E1362K probably damaging Het
Atp10b A G 11: 43,230,564 Q1018R probably benign Het
Atp1a2 G A 1: 172,279,344 T803I probably damaging Het
Atr T G 9: 95,932,442 L2064R probably damaging Het
Bmp3 T A 5: 98,872,405 L229Q probably damaging Het
Ccl25 A G 8: 4,353,892 *54W probably null Het
Cdc45 A T 16: 18,808,741 N111K possibly damaging Het
Cfap61 T A 2: 145,963,443 S154T probably benign Het
Cyp2c37 T A 19: 39,994,098 S127T probably benign Het
Cyp4f40 T A 17: 32,673,939 D309E probably benign Het
D6Ertd527e A G 6: 87,111,353 D166G unknown Het
Dmbt1 T A 7: 131,050,214 D395E probably damaging Het
Dnah5 A G 15: 28,370,409 S2832G probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fah T C 7: 84,593,212 D296G probably damaging Het
Fam83g A G 11: 61,702,678 N346S probably damaging Het
Fgl1 T A 8: 41,191,601 T289S possibly damaging Het
Fmo1 A C 1: 162,833,862 L284R probably damaging Het
Frem3 T A 8: 80,668,801 M1819K probably benign Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Fut1 T C 7: 45,619,428 W269R probably damaging Het
Ggnbp2 A G 11: 84,833,129 Y638H probably damaging Het
Gp2 T A 7: 119,451,630 I293F probably benign Het
Gpi1 T C 7: 34,230,155 N20S probably benign Het
Gxylt1 C T 15: 93,254,392 R222H probably damaging Het
Hemgn T C 4: 46,396,091 K382E possibly damaging Het
Irf6 G A 1: 193,169,305 M401I probably benign Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Lactb T A 9: 66,970,919 R209S probably damaging Het
Lonp2 A G 8: 86,641,584 D342G probably damaging Het
Mmachc T C 4: 116,705,997 S54G probably damaging Het
Mpp7 C A 18: 7,350,977 W573C probably damaging Het
Olfr1133 T A 2: 87,645,838 Y95F probably benign Het
Olfr1415 A T 1: 92,490,888 I289N probably damaging Het
Olfr70 T A 4: 43,697,011 H54L possibly damaging Het
Pappa2 A T 1: 158,936,554 D462E probably benign Het
Pcdh12 A T 18: 38,283,443 F210I probably damaging Het
Ppp1r12c A G 7: 4,484,444 probably null Het
Prkce T A 17: 86,496,018 D448E possibly damaging Het
Ptprb C A 10: 116,339,679 T1193K probably damaging Het
Qrfpr T A 3: 36,182,660 E197D possibly damaging Het
Rusc2 T A 4: 43,416,568 C625S probably benign Het
Shcbp1 T G 8: 4,741,968 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spag5 T A 11: 78,305,317 C449* probably null Het
Stpg3 T C 2: 25,213,850 D158G probably damaging Het
Sycp2 T C 2: 178,347,797 Y1423C probably benign Het
Tiprl C T 1: 165,215,790 E256K possibly damaging Het
Tmem132c T A 5: 127,563,567 V934D probably damaging Het
Topors A G 4: 40,261,982 V434A probably benign Het
Usp11 A G X: 20,718,707 Y731C probably damaging Het
Vmn2r58 T A 7: 41,863,963 I419L probably benign Het
Wfs1 C A 5: 36,982,078 R72L possibly damaging Het
Zan T C 5: 137,427,939 D2525G unknown Het
Zfp280c A G X: 48,563,838 V285A probably benign Het
Zfp511 T A 7: 140,037,615 F177I probably damaging Het
Zfp964 A G 8: 69,663,070 M107V unknown Het
Zmynd11 A G 13: 9,710,220 Y122H probably damaging Het
Other mutations in Hook3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hook3 APN 8 26059250 missense possibly damaging 0.46
IGL01066:Hook3 APN 8 26048298 missense probably damaging 1.00
IGL01145:Hook3 APN 8 26059344 missense probably benign 0.00
IGL01514:Hook3 APN 8 26088189 missense possibly damaging 0.69
IGL01727:Hook3 APN 8 26070159 missense probably benign 0.00
IGL01832:Hook3 APN 8 26072365 missense possibly damaging 0.87
IGL01874:Hook3 APN 8 26039732 missense possibly damaging 0.71
IGL01931:Hook3 APN 8 26088055 splice site probably benign
IGL01948:Hook3 APN 8 26059312 missense possibly damaging 0.95
IGL02209:Hook3 APN 8 26070265 missense probably damaging 0.99
IGL02675:Hook3 APN 8 26061434 missense possibly damaging 0.64
IGL02750:Hook3 APN 8 26095754 splice site probably benign
Rufio UTSW 8 26034940 nonsense probably null
R0384:Hook3 UTSW 8 26044235 splice site probably null
R0600:Hook3 UTSW 8 26118986 missense probably benign
R1037:Hook3 UTSW 8 26072350 missense possibly damaging 0.92
R1563:Hook3 UTSW 8 26110752 missense probably benign 0.06
R1767:Hook3 UTSW 8 26071056 critical splice donor site probably null
R1806:Hook3 UTSW 8 26068659 missense probably damaging 1.00
R2025:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2026:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2027:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2091:Hook3 UTSW 8 26059394 splice site probably benign
R2153:Hook3 UTSW 8 26070197 missense probably damaging 1.00
R2184:Hook3 UTSW 8 26118983 missense probably benign 0.00
R4586:Hook3 UTSW 8 26032011 missense probably damaging 0.98
R4863:Hook3 UTSW 8 26038029 missense probably damaging 1.00
R4971:Hook3 UTSW 8 26082579 missense probably benign 0.22
R5023:Hook3 UTSW 8 26032019 frame shift probably null
R5026:Hook3 UTSW 8 26110757 missense probably damaging 0.98
R5068:Hook3 UTSW 8 26095757 critical splice donor site probably null
R5253:Hook3 UTSW 8 26072291 missense probably benign
R5383:Hook3 UTSW 8 26118989 missense probably benign 0.01
R5437:Hook3 UTSW 8 26061422 missense probably benign 0.05
R5528:Hook3 UTSW 8 26072293 missense probably damaging 1.00
R5551:Hook3 UTSW 8 26068611 missense possibly damaging 0.75
R5846:Hook3 UTSW 8 26044327 intron probably benign
R5907:Hook3 UTSW 8 26044278 intron probably benign
R6082:Hook3 UTSW 8 26110785 missense probably benign 0.00
R6124:Hook3 UTSW 8 26059272 missense probably benign 0.20
R6301:Hook3 UTSW 8 26034940 nonsense probably null
R6314:Hook3 UTSW 8 26088108 missense probably benign
R6448:Hook3 UTSW 8 26093664 missense probably benign 0.02
R6810:Hook3 UTSW 8 26032422 splice site probably null
R7168:Hook3 UTSW 8 26071086 missense probably benign 0.02
R7856:Hook3 UTSW 8 26035221 missense probably damaging 1.00
R7988:Hook3 UTSW 8 26073647 missense probably benign 0.02
R8079:Hook3 UTSW 8 26088058 critical splice donor site probably null
R9121:Hook3 UTSW 8 26035167 missense probably damaging 1.00
R9223:Hook3 UTSW 8 26032524 missense
R9244:Hook3 UTSW 8 26071056 critical splice donor site probably null
R9246:Hook3 UTSW 8 26072291 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATACTTCCAGGCTAGAGGACAGCATCG -3'
(R):5'- TGAGCCTCACACTGCCCACC -3'

Sequencing Primer
(F):5'- AGGACAGCATCGCTGGG -3'
(R):5'- acaaccatccgtaacaagacc -3'
Posted On 2014-03-14