Incidental Mutation 'R1413:Dmbt1'
ID159695
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Namedeleted in malignant brain tumors 1
SynonymsCRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin
MMRRC Submission 039469-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R1413 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location131032053-131121630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131050214 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 395 (D395E)
Ref Sequence ENSEMBL: ENSMUSP00000148657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
Predicted Effect unknown
Transcript: ENSMUST00000084509
AA Change: D280E
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: D280E

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208311
AA Change: D291E
Predicted Effect probably damaging
Transcript: ENSMUST00000213064
AA Change: D395E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,590,496 V1504A probably damaging Het
Abcc9 T C 6: 142,627,519 N1051D possibly damaging Het
Actr6 A T 10: 89,728,157 Y84* probably null Het
Adgrl3 T C 5: 81,693,519 Y816H probably damaging Het
Ahcyl2 T C 6: 29,768,587 probably benign Het
Amd1 A T 10: 40,290,408 C157* probably null Het
Ank1 G A 8: 23,119,377 E1362K probably damaging Het
Atp10b A G 11: 43,230,564 Q1018R probably benign Het
Atp1a2 G A 1: 172,279,344 T803I probably damaging Het
Atr T G 9: 95,932,442 L2064R probably damaging Het
Bmp3 T A 5: 98,872,405 L229Q probably damaging Het
Ccl25 A G 8: 4,353,892 *54W probably null Het
Cdc45 A T 16: 18,808,741 N111K possibly damaging Het
Cfap61 T A 2: 145,963,443 S154T probably benign Het
Cyp2c37 T A 19: 39,994,098 S127T probably benign Het
Cyp4f40 T A 17: 32,673,939 D309E probably benign Het
D6Ertd527e A G 6: 87,111,353 D166G unknown Het
Dnah5 A G 15: 28,370,409 S2832G probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fah T C 7: 84,593,212 D296G probably damaging Het
Fam83g A G 11: 61,702,678 N346S probably damaging Het
Fgl1 T A 8: 41,191,601 T289S possibly damaging Het
Fmo1 A C 1: 162,833,862 L284R probably damaging Het
Frem3 T A 8: 80,668,801 M1819K probably benign Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Fut1 T C 7: 45,619,428 W269R probably damaging Het
Ggnbp2 A G 11: 84,833,129 Y638H probably damaging Het
Gp2 T A 7: 119,451,630 I293F probably benign Het
Gpi1 T C 7: 34,230,155 N20S probably benign Het
Gxylt1 C T 15: 93,254,392 R222H probably damaging Het
Hemgn T C 4: 46,396,091 K382E possibly damaging Het
Hook3 T A 8: 26,038,106 E585D probably damaging Het
Irf6 G A 1: 193,169,305 M401I probably benign Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Lactb T A 9: 66,970,919 R209S probably damaging Het
Lonp2 A G 8: 86,641,584 D342G probably damaging Het
Mmachc T C 4: 116,705,997 S54G probably damaging Het
Mpp7 C A 18: 7,350,977 W573C probably damaging Het
Olfr1133 T A 2: 87,645,838 Y95F probably benign Het
Olfr1415 A T 1: 92,490,888 I289N probably damaging Het
Olfr70 T A 4: 43,697,011 H54L possibly damaging Het
Pappa2 A T 1: 158,936,554 D462E probably benign Het
Pcdh12 A T 18: 38,283,443 F210I probably damaging Het
Ppp1r12c A G 7: 4,484,444 probably null Het
Prkce T A 17: 86,496,018 D448E possibly damaging Het
Ptprb C A 10: 116,339,679 T1193K probably damaging Het
Qrfpr T A 3: 36,182,660 E197D possibly damaging Het
Rusc2 T A 4: 43,416,568 C625S probably benign Het
Shcbp1 T G 8: 4,741,968 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spag5 T A 11: 78,305,317 C449* probably null Het
Stpg3 T C 2: 25,213,850 D158G probably damaging Het
Sycp2 T C 2: 178,347,797 Y1423C probably benign Het
Tiprl C T 1: 165,215,790 E256K possibly damaging Het
Tmem132c T A 5: 127,563,567 V934D probably damaging Het
Topors A G 4: 40,261,982 V434A probably benign Het
Usp11 A G X: 20,718,707 Y731C probably damaging Het
Vmn2r58 T A 7: 41,863,963 I419L probably benign Het
Wfs1 C A 5: 36,982,078 R72L possibly damaging Het
Zan T C 5: 137,427,939 D2525G unknown Het
Zfp280c A G X: 48,563,838 V285A probably benign Het
Zfp511 T A 7: 140,037,615 F177I probably damaging Het
Zfp964 A G 8: 69,663,070 M107V unknown Het
Zmynd11 A G 13: 9,710,220 Y122H probably damaging Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 131079540 intron probably benign
IGL00161:Dmbt1 APN 7 131109628 missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 131099290 missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 131082500 missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 131097607 missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 131058158 missense probably benign 0.26
IGL01072:Dmbt1 APN 7 131085368 splice site probably benign
IGL01317:Dmbt1 APN 7 131041191 missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 131088767 missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 131103679 missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 131116728 missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 131081185 missense probably benign 0.14
IGL01890:Dmbt1 APN 7 131074419 intron probably benign
IGL02160:Dmbt1 APN 7 131082688 missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 131093256 splice site probably benign
IGL02197:Dmbt1 APN 7 131085422 splice site probably benign
IGL02332:Dmbt1 APN 7 131066613 intron probably benign
IGL02427:Dmbt1 APN 7 131088085 splice site probably null
IGL02726:Dmbt1 APN 7 131074410 intron probably benign
IGL02967:Dmbt1 APN 7 131071189 missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 131082679 missense probably benign 0.05
IGL03089:Dmbt1 APN 7 131111049 missense probably damaging 0.99
H8562:Dmbt1 UTSW 7 131112076 nonsense probably null
K3955:Dmbt1 UTSW 7 131119564 missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 131106393 missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 131096049 splice site probably benign
R0427:Dmbt1 UTSW 7 131040902 nonsense probably null
R0478:Dmbt1 UTSW 7 131041187 missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 131097673 splice site probably null
R0538:Dmbt1 UTSW 7 131049901 splice site probably benign
R0626:Dmbt1 UTSW 7 131102081 missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 131097653 missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 131093117 missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 131074524 critical splice donor site probably null
R1458:Dmbt1 UTSW 7 131044487 splice site probably benign
R1463:Dmbt1 UTSW 7 131109637 critical splice donor site probably null
R1509:Dmbt1 UTSW 7 131074331 intron probably benign
R1990:Dmbt1 UTSW 7 131058288 missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 131106359 missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 131099133 missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 131050018 missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 131102032 missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 131097575 missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 131046562 missense probably benign 0.03
R2256:Dmbt1 UTSW 7 131090494 missense probably benign 0.01
R2391:Dmbt1 UTSW 7 131106468 missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 131094734 nonsense probably null
R3014:Dmbt1 UTSW 7 131032097 intron probably benign
R3155:Dmbt1 UTSW 7 131050157 nonsense probably null
R3176:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3276:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3442:Dmbt1 UTSW 7 131106249 missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 131112090 missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 131074202 intron probably benign
R4396:Dmbt1 UTSW 7 131116632 missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 131040934 missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 131050012 missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 131094742 missense probably benign 0.01
R5156:Dmbt1 UTSW 7 131097670 critical splice donor site probably null
R5225:Dmbt1 UTSW 7 131094735 missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 131082619 missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 131041021 missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 131119511 missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 131040993 missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 131063403 intron probably benign
R5526:Dmbt1 UTSW 7 131041190 missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 131099300 nonsense probably null
R5566:Dmbt1 UTSW 7 131106273 missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 131054067 missense probably benign 0.17
R6154:Dmbt1 UTSW 7 131109641 splice site probably null
R6188:Dmbt1 UTSW 7 131097631 missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 131058254 missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 131103578 missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 131116641 missense probably benign 0.01
R6603:Dmbt1 UTSW 7 131046510 intron probably null
R6719:Dmbt1 UTSW 7 131119603 missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 131046561 missense probably benign 0.16
R7148:Dmbt1 UTSW 7 131066734 nonsense probably null
R7191:Dmbt1 UTSW 7 131044520 missense unknown
R7269:Dmbt1 UTSW 7 131066621 missense unknown
R7288:Dmbt1 UTSW 7 131083789 nonsense probably null
R7296:Dmbt1 UTSW 7 131112132 missense unknown
R7349:Dmbt1 UTSW 7 131041124 missense unknown
R7386:Dmbt1 UTSW 7 131112236 missense unknown
R7428:Dmbt1 UTSW 7 131108463 missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 131079511 critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 131066462 missense unknown
R7513:Dmbt1 UTSW 7 131090512 missense unknown
R7553:Dmbt1 UTSW 7 131104867 missense unknown
R7567:Dmbt1 UTSW 7 131061363 splice site probably null
X0024:Dmbt1 UTSW 7 131112248 nonsense probably null
X0062:Dmbt1 UTSW 7 131094851 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCAGTGATGCCAACGTGGTGTG -3'
(R):5'- ACCAAAGCTGGATTACCCCTTGC -3'

Sequencing Primer
(F):5'- CCAACGTGGTGTGCAGAC -3'
(R):5'- CTCACTAGAGACTGAGAGCCTTG -3'
Posted On2014-03-14