Incidental Mutation 'R1413:Rusc2'
ID 159675
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene Name RUN and SH3 domain containing 2
Synonyms
MMRRC Submission 039469-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R1413 (G1)
Quality Score 88
Status Not validated
Chromosome 4
Chromosomal Location 43381979-43427088 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43416568 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 625 (C625S)
Ref Sequence ENSEMBL: ENSMUSP00000118528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000098106] [ENSMUST00000125399] [ENSMUST00000131668] [ENSMUST00000135216] [ENSMUST00000173682] [ENSMUST00000149221] [ENSMUST00000136360] [ENSMUST00000152322] [ENSMUST00000144911] [ENSMUST00000139198]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035645
AA Change: C625S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: C625S

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098106
AA Change: C625S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: C625S

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125393
Predicted Effect probably benign
Transcript: ENSMUST00000125399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131037
Predicted Effect probably benign
Transcript: ENSMUST00000131668
AA Change: C625S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: C625S

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146710
Predicted Effect probably benign
Transcript: ENSMUST00000173682
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect probably benign
Transcript: ENSMUST00000136360
SMART Domains Protein: ENSMUSP00000123431
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152322
Predicted Effect probably benign
Transcript: ENSMUST00000144911
Predicted Effect probably benign
Transcript: ENSMUST00000139198
SMART Domains Protein: ENSMUSP00000121528
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,573,245 (GRCm39) N1051D possibly damaging Het
Abcc9 A G 6: 142,536,222 (GRCm39) V1504A probably damaging Het
Actr6 A T 10: 89,564,019 (GRCm39) Y84* probably null Het
Adgrl3 T C 5: 81,841,366 (GRCm39) Y816H probably damaging Het
Ahcyl2 T C 6: 29,768,586 (GRCm39) probably benign Het
Amd1 A T 10: 40,166,404 (GRCm39) C157* probably null Het
Ank1 G A 8: 23,609,393 (GRCm39) E1362K probably damaging Het
Atp10b A G 11: 43,121,391 (GRCm39) Q1018R probably benign Het
Atp1a2 G A 1: 172,106,911 (GRCm39) T803I probably damaging Het
Atr T G 9: 95,814,495 (GRCm39) L2064R probably damaging Het
Bmp3 T A 5: 99,020,264 (GRCm39) L229Q probably damaging Het
Ccl25 A G 8: 4,403,892 (GRCm39) *54W probably null Het
Cdc45 A T 16: 18,627,491 (GRCm39) N111K possibly damaging Het
Cfap61 T A 2: 145,805,363 (GRCm39) S154T probably benign Het
Cyp2c37 T A 19: 39,982,542 (GRCm39) S127T probably benign Het
Cyp4f40 T A 17: 32,892,913 (GRCm39) D309E probably benign Het
D6Ertd527e A G 6: 87,088,335 (GRCm39) D166G unknown Het
Dmbt1 T A 7: 130,651,944 (GRCm39) D395E probably damaging Het
Dnah5 A G 15: 28,370,555 (GRCm39) S2832G probably benign Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Fah T C 7: 84,242,420 (GRCm39) D296G probably damaging Het
Fam83g A G 11: 61,593,504 (GRCm39) N346S probably damaging Het
Fgl1 T A 8: 41,644,638 (GRCm39) T289S possibly damaging Het
Fmo1 A C 1: 162,661,431 (GRCm39) L284R probably damaging Het
Frem3 T A 8: 81,395,430 (GRCm39) M1819K probably benign Het
Fsip2 T A 2: 82,818,762 (GRCm39) L4832M possibly damaging Het
Fut1 T C 7: 45,268,852 (GRCm39) W269R probably damaging Het
Ggnbp2 A G 11: 84,723,955 (GRCm39) Y638H probably damaging Het
Gp2 T A 7: 119,050,853 (GRCm39) I293F probably benign Het
Gpi1 T C 7: 33,929,580 (GRCm39) N20S probably benign Het
Gxylt1 C T 15: 93,152,273 (GRCm39) R222H probably damaging Het
Hemgn T C 4: 46,396,091 (GRCm39) K382E possibly damaging Het
Hook3 T A 8: 26,528,134 (GRCm39) E585D probably damaging Het
Irf6 G A 1: 192,851,613 (GRCm39) M401I probably benign Het
Jmjd1c A G 10: 67,085,529 (GRCm39) T2259A probably damaging Het
Lactb T A 9: 66,878,201 (GRCm39) R209S probably damaging Het
Lonp2 A G 8: 87,368,212 (GRCm39) D342G probably damaging Het
Mmachc T C 4: 116,563,194 (GRCm39) S54G probably damaging Het
Mpp7 C A 18: 7,350,977 (GRCm39) W573C probably damaging Het
Or13e8 T A 4: 43,697,011 (GRCm39) H54L possibly damaging Het
Or5w1b T A 2: 87,476,182 (GRCm39) Y95F probably benign Het
Or6b2b A T 1: 92,418,610 (GRCm39) I289N probably damaging Het
Pappa2 A T 1: 158,764,124 (GRCm39) D462E probably benign Het
Pcdh12 A T 18: 38,416,496 (GRCm39) F210I probably damaging Het
Ppp1r12c A G 7: 4,487,443 (GRCm39) probably null Het
Prkce T A 17: 86,803,446 (GRCm39) D448E possibly damaging Het
Ptprb C A 10: 116,175,584 (GRCm39) T1193K probably damaging Het
Qrfpr T A 3: 36,236,809 (GRCm39) E197D possibly damaging Het
Shcbp1 T G 8: 4,791,968 (GRCm39) probably null Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spag5 T A 11: 78,196,143 (GRCm39) C449* probably null Het
Stpg3 T C 2: 25,103,862 (GRCm39) D158G probably damaging Het
Sycp2 T C 2: 177,989,590 (GRCm39) Y1423C probably benign Het
Tiprl C T 1: 165,043,359 (GRCm39) E256K possibly damaging Het
Tmem132c T A 5: 127,640,631 (GRCm39) V934D probably damaging Het
Topors A G 4: 40,261,982 (GRCm39) V434A probably benign Het
Usp11 A G X: 20,584,946 (GRCm39) Y731C probably damaging Het
Vmn2r58 T A 7: 41,513,387 (GRCm39) I419L probably benign Het
Wfs1 C A 5: 37,139,422 (GRCm39) R72L possibly damaging Het
Zan T C 5: 137,426,201 (GRCm39) D2525G unknown Het
Zfp280c A G X: 47,652,715 (GRCm39) V285A probably benign Het
Zfp511 T A 7: 139,617,528 (GRCm39) F177I probably damaging Het
Zfp964 A G 8: 70,115,720 (GRCm39) M107V unknown Het
Zmynd11 A G 13: 9,760,256 (GRCm39) Y122H probably damaging Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43,426,116 (GRCm39) missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43,416,434 (GRCm39) missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43,415,840 (GRCm39) missense probably benign 0.08
IGL01628:Rusc2 APN 4 43,425,729 (GRCm39) missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43,415,738 (GRCm39) missense probably benign 0.02
IGL02030:Rusc2 APN 4 43,416,095 (GRCm39) missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43,425,668 (GRCm39) missense probably benign
IGL02115:Rusc2 APN 4 43,426,136 (GRCm39) splice site probably benign
IGL02122:Rusc2 APN 4 43,421,685 (GRCm39) missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43,425,351 (GRCm39) missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43,425,351 (GRCm39) missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43,415,545 (GRCm39) missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43,416,376 (GRCm39) missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43,425,806 (GRCm39) missense probably benign 0.00
P0026:Rusc2 UTSW 4 43,415,840 (GRCm39) missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43,424,009 (GRCm39) missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43,424,100 (GRCm39) splice site probably benign
R0068:Rusc2 UTSW 4 43,424,100 (GRCm39) splice site probably benign
R0114:Rusc2 UTSW 4 43,422,055 (GRCm39) missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43,423,954 (GRCm39) missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43,425,486 (GRCm39) missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43,416,137 (GRCm39) missense probably damaging 1.00
R1416:Rusc2 UTSW 4 43,421,617 (GRCm39) missense possibly damaging 0.86
R1731:Rusc2 UTSW 4 43,426,046 (GRCm39) missense probably benign
R1864:Rusc2 UTSW 4 43,421,719 (GRCm39) missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43,421,749 (GRCm39) missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43,415,212 (GRCm39) missense probably benign 0.06
R2212:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43,416,260 (GRCm39) missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43,415,456 (GRCm39) missense probably benign 0.28
R2886:Rusc2 UTSW 4 43,415,456 (GRCm39) missense probably benign 0.28
R3412:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43,416,424 (GRCm39) missense probably benign 0.45
R4135:Rusc2 UTSW 4 43,425,563 (GRCm39) missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43,415,533 (GRCm39) missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43,416,080 (GRCm39) missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43,423,942 (GRCm39) missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43,415,926 (GRCm39) missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43,415,240 (GRCm39) missense probably benign 0.05
R5131:Rusc2 UTSW 4 43,414,948 (GRCm39) missense probably benign 0.03
R5177:Rusc2 UTSW 4 43,421,805 (GRCm39) splice site probably null
R5540:Rusc2 UTSW 4 43,423,975 (GRCm39) missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43,415,932 (GRCm39) nonsense probably null
R5628:Rusc2 UTSW 4 43,425,348 (GRCm39) missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43,425,758 (GRCm39) missense probably benign 0.06
R6129:Rusc2 UTSW 4 43,424,271 (GRCm39) missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43,416,416 (GRCm39) missense probably benign 0.30
R6633:Rusc2 UTSW 4 43,414,852 (GRCm39) missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43,422,846 (GRCm39) missense probably benign 0.35
R7491:Rusc2 UTSW 4 43,426,528 (GRCm39) missense probably damaging 1.00
R7641:Rusc2 UTSW 4 43,425,335 (GRCm39) missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43,414,900 (GRCm39) nonsense probably null
R7710:Rusc2 UTSW 4 43,416,119 (GRCm39) missense probably benign 0.07
R8052:Rusc2 UTSW 4 43,421,851 (GRCm39) missense probably benign
R8061:Rusc2 UTSW 4 43,422,492 (GRCm39) missense probably damaging 1.00
R8127:Rusc2 UTSW 4 43,423,747 (GRCm39) missense possibly damaging 0.54
R8319:Rusc2 UTSW 4 43,425,378 (GRCm39) missense probably damaging 1.00
R8355:Rusc2 UTSW 4 43,422,846 (GRCm39) missense probably benign 0.35
R8397:Rusc2 UTSW 4 43,424,206 (GRCm39) missense possibly damaging 0.95
R8455:Rusc2 UTSW 4 43,422,846 (GRCm39) missense probably benign 0.35
R8553:Rusc2 UTSW 4 43,416,508 (GRCm39) missense probably benign 0.05
R8725:Rusc2 UTSW 4 43,401,351 (GRCm39) intron probably benign
R8725:Rusc2 UTSW 4 43,415,396 (GRCm39) missense probably damaging 0.99
R8727:Rusc2 UTSW 4 43,401,351 (GRCm39) intron probably benign
R8834:Rusc2 UTSW 4 43,416,431 (GRCm39) missense possibly damaging 0.94
R9295:Rusc2 UTSW 4 43,416,382 (GRCm39) missense probably damaging 0.98
R9483:Rusc2 UTSW 4 43,415,897 (GRCm39) missense probably damaging 0.97
R9666:Rusc2 UTSW 4 43,416,262 (GRCm39) missense probably benign 0.21
R9705:Rusc2 UTSW 4 43,424,936 (GRCm39) missense probably benign 0.00
X0025:Rusc2 UTSW 4 43,422,226 (GRCm39) missense probably benign 0.00
X0066:Rusc2 UTSW 4 43,422,204 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGTTACCTCCTTCGCTGAGTTG -3'
(R):5'- TTTCCCAGGACACCAGTCTCCAAG -3'

Sequencing Primer
(F):5'- AAGAAAGCTGCGGGCTCC -3'
(R):5'- ACCAGTCTCCAAGTCCTAGTG -3'
Posted On 2014-03-14