Incidental Mutation 'R1521:Ctnna3'
ID167012
Institutional Source Beutler Lab
Gene Symbol Ctnna3
Ensembl Gene ENSMUSG00000060843
Gene Namecatenin (cadherin associated protein), alpha 3
SynonymsCatna3, Vr22, alphaT-catenin, 4930429L08Rik
MMRRC Submission 040870-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1521 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location63430098-65003667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64959842 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 780 (K780E)
Ref Sequence ENSEMBL: ENSMUSP00000101081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075099] [ENSMUST00000105440] [ENSMUST00000105441]
Predicted Effect probably benign
Transcript: ENSMUST00000075099
AA Change: K780E

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000074606
Gene: ENSMUSG00000060843
AA Change: K780E

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105440
AA Change: K780E

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101080
Gene: ENSMUSG00000060843
AA Change: K780E

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105441
AA Change: K780E

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101081
Gene: ENSMUSG00000060843
AA Change: K780E

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the vinculin/alpha-catenin family. The encoded protein plays a role in cell-cell adhesion in muscle cells. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia, familial 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased heart weight, increased ventricle size, dilated cardiomyopathy and increased susceptibility to ischemia-induced arrhythmias and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,987,235 L104P possibly damaging Het
Adgrf5 T C 17: 43,430,552 V360A probably benign Het
Ahnak G A 19: 9,004,728 M1125I probably benign Het
Akap12 T C 10: 4,354,804 V538A probably benign Het
Arhgef10l T C 4: 140,515,438 D1088G possibly damaging Het
Atp7b A T 8: 22,027,673 L268Q probably damaging Het
Atxn2 A C 5: 121,779,591 N516T probably damaging Het
Cacna1h T C 17: 25,397,354 M184V possibly damaging Het
Cacnb2 G T 2: 14,614,352 R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 E96G probably damaging Het
Ccdc78 G T 17: 25,788,781 R264L probably damaging Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Cog7 C T 7: 121,930,574 D615N possibly damaging Het
Crtc2 T C 3: 90,257,383 V115A probably benign Het
Crybg1 A G 10: 43,998,416 S899P probably damaging Het
Ctdnep1 T A 11: 69,988,635 V128E probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dazap2 T A 15: 100,618,065 Y91* probably null Het
Dcdc5 T C 2: 106,351,669 noncoding transcript Het
Dppa1 T A 11: 46,610,473 R74S possibly damaging Het
Elovl1 A T 4: 118,432,000 T241S probably benign Het
Eya1 G T 1: 14,274,550 Q86K probably damaging Het
Fam71a T A 1: 191,164,022 R141S probably benign Het
Fancm A T 12: 65,121,704 M1614L probably benign Het
Fcgbp C T 7: 28,075,160 T53I probably benign Het
Fpr3 T A 17: 17,971,015 W183R probably damaging Het
Galnt13 G A 2: 54,854,645 V119I probably benign Het
Gcfc2 T C 6: 81,923,812 S36P probably benign Het
Gdap2 T A 3: 100,194,615 D412E possibly damaging Het
Gm10184 T A 17: 89,910,306 N4I possibly damaging Het
Gm12258 T C 11: 58,859,555 C41R probably damaging Het
Grrp1 T C 4: 134,251,350 *272W probably null Het
Hipk1 T G 3: 103,777,782 E172D probably benign Het
Hmgcs1 T G 13: 119,703,591 L326R probably benign Het
Hs6st1 C A 1: 36,068,886 R77S probably damaging Het
Ifit3 A T 19: 34,587,173 N40Y probably damaging Het
Il1a T A 2: 129,304,741 Q144L possibly damaging Het
Itga7 A G 10: 128,957,811 E1128G possibly damaging Het
Itih2 T C 2: 10,106,747 D460G probably damaging Het
Ivns1abp G A 1: 151,351,558 C39Y probably damaging Het
Kif22 G T 7: 127,027,839 A646E probably damaging Het
Klhl29 T C 12: 5,091,307 Y559C probably damaging Het
Klhl7 T A 5: 24,149,110 probably null Het
Klhl9 A G 4: 88,721,993 S4P probably benign Het
Klk10 A G 7: 43,782,880 Q79R probably benign Het
Klk6 T C 7: 43,829,275 probably null Het
Lamc2 C T 1: 153,166,263 E42K probably benign Het
Lingo3 T C 10: 80,835,721 D125G probably benign Het
Map1b T C 13: 99,432,739 N1158S unknown Het
Masp1 T A 16: 23,494,637 N183Y probably damaging Het
Mdga2 A G 12: 66,568,926 Y636H probably benign Het
Micalcl T A 7: 112,381,610 S264T probably damaging Het
Mif A G 10: 75,859,541 V95A possibly damaging Het
Mmp17 G A 5: 129,595,088 probably null Het
Mmp23 T C 4: 155,650,717 R390G possibly damaging Het
Ncoa6 A C 2: 155,415,222 S800R possibly damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nr2e3 A T 9: 59,949,205 S67R probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr1256 G A 2: 89,835,172 R258* probably null Het
Olfr172 C T 16: 58,760,853 E108K probably damaging Het
Olfr591 T A 7: 103,173,451 Y62F probably benign Het
Olfr845 C T 9: 19,338,652 S64F probably benign Het
Olfr872 A C 9: 20,260,432 Q197H possibly damaging Het
Olfr916 T G 9: 38,657,718 I225L probably damaging Het
Olfr958 A T 9: 39,550,784 V29E possibly damaging Het
Otog A T 7: 46,259,264 H562L possibly damaging Het
Pcdh15 T C 10: 74,594,191 V1250A probably damaging Het
Pde1c A G 6: 56,173,607 V309A possibly damaging Het
Pfkfb4 A C 9: 109,007,305 T134P probably damaging Het
Phc3 G T 3: 30,936,575 Q498K possibly damaging Het
Phlpp1 T C 1: 106,392,319 V1348A probably damaging Het
Pik3ap1 T C 19: 41,321,558 D441G probably damaging Het
Pkd1l2 T C 8: 117,065,500 probably null Het
Pla2g4a T C 1: 149,857,686 probably null Het
Pola2 A T 19: 5,948,406 I376N probably damaging Het
Pold2 T A 11: 5,876,833 N34Y probably damaging Het
Ppp2r5c T C 12: 110,554,886 L281P probably damaging Het
Prss46 A G 9: 110,849,635 I29V probably benign Het
Ranbp6 A T 19: 29,811,446 V502E probably benign Het
Rdh14 T C 12: 10,394,613 F155L probably damaging Het
Rnaseh2a A T 8: 84,965,858 probably null Het
Rpp30 A G 19: 36,094,385 T118A possibly damaging Het
Rragd T C 4: 32,996,005 F117L probably damaging Het
S100a2 T A 3: 90,591,292 probably null Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Sh3tc2 A G 18: 62,008,488 E1080G probably damaging Het
Slc26a9 A G 1: 131,750,677 K27R probably damaging Het
Spata17 T A 1: 187,193,994 K46N probably damaging Het
St14 A C 9: 31,108,215 D103E probably benign Het
St6galnac2 T A 11: 116,684,347 Q222L possibly damaging Het
Tdrd9 T C 12: 112,036,410 V831A probably damaging Het
Tert A G 13: 73,642,056 E843G probably damaging Het
Tex21 A G 12: 76,204,270 V464A probably benign Het
Tmem232 T A 17: 65,484,501 H124L probably damaging Het
Tmem5 A G 10: 122,090,479 W243R probably damaging Het
Tnfrsf19 T G 14: 61,005,106 S110R probably damaging Het
Tnnt3 A T 7: 142,515,825 K272* probably null Het
Tnxb T C 17: 34,711,503 L2054P probably damaging Het
Trcg1 A C 9: 57,242,465 D440A probably benign Het
Trpm3 A G 19: 22,901,221 E504G probably damaging Het
Trpm5 C T 7: 143,082,889 R437H probably benign Het
Ttn T C 2: 76,741,167 R18134G probably damaging Het
Uchl5 A C 1: 143,798,422 M64L possibly damaging Het
Urb1 G A 16: 90,753,863 R2034W probably damaging Het
Usp44 T A 10: 93,847,186 C452* probably null Het
Uvssa G A 5: 33,413,934 A641T probably damaging Het
Vmn1r204 T A 13: 22,557,078 I293N probably benign Het
Vmn2r84 A T 10: 130,389,268 C458S probably benign Het
Vmn2r85 T G 10: 130,425,919 H183P probably damaging Het
Vps13d G T 4: 145,105,861 T2825K probably benign Het
Zc3hc1 T A 6: 30,376,025 I179F probably benign Het
Zfp112 A G 7: 24,125,785 N393D probably damaging Het
Zfp558 A G 9: 18,456,563 S310P possibly damaging Het
Zfp560 A C 9: 20,348,775 probably null Het
Zfp668 C T 7: 127,867,080 E311K probably benign Het
Zfp763 T A 17: 33,033,302 M1L probably benign Het
Zfp947 A T 17: 22,145,832 M287K probably benign Het
Other mutations in Ctnna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ctnna3 APN 10 63566833 missense probably damaging 1.00
IGL00823:Ctnna3 APN 10 63537543 missense possibly damaging 0.68
IGL00963:Ctnna3 APN 10 64945949 missense probably damaging 1.00
IGL01388:Ctnna3 APN 10 63504107 missense possibly damaging 0.67
IGL01655:Ctnna3 APN 10 64873170 missense probably benign 0.01
IGL01783:Ctnna3 APN 10 63820469 missense possibly damaging 0.91
IGL01909:Ctnna3 APN 10 63504131 missense probably benign 0.11
IGL02160:Ctnna3 APN 10 64250698 missense probably benign
IGL02267:Ctnna3 APN 10 64945998 missense probably benign 0.20
IGL02524:Ctnna3 APN 10 64260826 missense possibly damaging 0.68
IGL02707:Ctnna3 APN 10 63504065 missense probably benign
IGL03165:Ctnna3 APN 10 64945941 missense probably damaging 0.98
Bipolar UTSW 10 64873207 missense probably damaging 0.96
Catatonia UTSW 10 64585995 missense probably benign
hebephrenia UTSW 10 64260935 missense probably benign 0.17
multiple UTSW 10 64250768 missense probably damaging 1.00
PIT4687001:Ctnna3 UTSW 10 64834606 missense probably damaging 1.00
R0345:Ctnna3 UTSW 10 63566840 missense probably benign 0.00
R0387:Ctnna3 UTSW 10 64586130 missense probably benign 0.00
R0523:Ctnna3 UTSW 10 64675909 missense probably damaging 0.97
R0647:Ctnna3 UTSW 10 63820424 missense probably benign 0.00
R0676:Ctnna3 UTSW 10 64409261 missense probably benign 0.20
R1102:Ctnna3 UTSW 10 64585995 missense probably benign
R1700:Ctnna3 UTSW 10 63852772 missense probably damaging 1.00
R1874:Ctnna3 UTSW 10 63504107 missense possibly damaging 0.67
R1995:Ctnna3 UTSW 10 63820364 missense probably damaging 0.98
R2088:Ctnna3 UTSW 10 64873207 missense probably damaging 0.96
R2198:Ctnna3 UTSW 10 65002745 missense probably benign 0.00
R4056:Ctnna3 UTSW 10 65002568 missense probably damaging 1.00
R4208:Ctnna3 UTSW 10 64959778 missense probably benign 0.22
R4440:Ctnna3 UTSW 10 64260935 missense probably benign 0.17
R4568:Ctnna3 UTSW 10 63852809 missense possibly damaging 0.56
R4594:Ctnna3 UTSW 10 64586079 missense probably benign 0.32
R4835:Ctnna3 UTSW 10 63581944 missense probably benign 0.01
R4849:Ctnna3 UTSW 10 64873315 missense probably damaging 1.00
R5682:Ctnna3 UTSW 10 64873306 missense probably damaging 0.96
R5777:Ctnna3 UTSW 10 64675885 missense probably benign
R6414:Ctnna3 UTSW 10 64260865 missense probably benign 0.35
R7210:Ctnna3 UTSW 10 64250768 missense probably damaging 1.00
R7220:Ctnna3 UTSW 10 64834589 missense probably benign 0.04
R7680:Ctnna3 UTSW 10 64487550 missense probably benign
R7934:Ctnna3 UTSW 10 64585968 missense probably damaging 1.00
R8006:Ctnna3 UTSW 10 63582011 missense probably benign 0.02
R8272:Ctnna3 UTSW 10 65002598 missense probably damaging 1.00
R8415:Ctnna3 UTSW 10 63504130 missense probably benign 0.05
Z1088:Ctnna3 UTSW 10 63581978 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGAAGTTGTTTCAACAGGAGCTTTCCA -3'
(R):5'- TATGAGAAAAGTACTGAGCCACACCCT -3'

Sequencing Primer
(F):5'- TCAACAGGAGCTTTCCAATGAAG -3'
(R):5'- TGAGCCACACCCTGGTTG -3'
Posted On2014-04-13