Incidental Mutation 'R1511:Nlrp5'
ID168309
Institutional Source Beutler Lab
Gene Symbol Nlrp5
Ensembl Gene ENSMUSG00000015721
Gene NameNLR family, pyrin domain containing 5
SynonymsMater, Nalp5, Op1
MMRRC Submission 039558-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1511 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23385889-23441922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23413347 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 143 (D143V)
Ref Sequence ENSEMBL: ENSMUSP00000122007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015866] [ENSMUST00000086341] [ENSMUST00000108441] [ENSMUST00000133237] [ENSMUST00000139661]
Predicted Effect probably benign
Transcript: ENSMUST00000015866
AA Change: D143V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000015866
Gene: ENSMUSG00000015721
AA Change: D143V

DomainStartEndE-ValueType
Pfam:NACHT 191 359 3.5e-45 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
LRR 975 1002 3.36e-7 SMART
LRR 1004 1031 6.04e1 SMART
LRR 1032 1059 1.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086341
SMART Domains Protein: ENSMUSP00000083524
Gene: ENSMUSG00000015721

DomainStartEndE-ValueType
Pfam:NACHT 175 343 1.5e-44 PFAM
LRR 675 702 4.51e1 SMART
LRR 731 758 1.36e-2 SMART
LRR 760 787 6.79e0 SMART
LRR 788 815 4.3e0 SMART
LRR 817 844 1.42e0 SMART
LRR 845 872 1.2e-3 SMART
LRR 874 901 1.2e2 SMART
LRR 902 929 2.2e-2 SMART
LRR 931 958 1.56e2 SMART
LRR 959 986 3.36e-7 SMART
LRR 988 1015 6.04e1 SMART
LRR 1016 1043 1.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108441
AA Change: D143V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104080
Gene: ENSMUSG00000015721
AA Change: D143V

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.5e-44 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
LRR 975 1002 3.36e-7 SMART
LRR 1004 1033 1.28e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133237
AA Change: D143V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122007
Gene: ENSMUSG00000015721
AA Change: D143V

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.3e-44 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139661
AA Change: D143V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118638
Gene: ENSMUSG00000015721
AA Change: D143V

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.6e-44 PFAM
Blast:LRR 691 718 8e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207536
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NACHT, leucine-rich repeat, and pyrin domain containing family. Members of this family have a pyrin domain at the N-terminus, a central NACHT domain, and a C-terminal leucine-rich repeat domain. This gene encodes a maternal-effect factor that is essential for early embryonic development in the mouse. Homozygous null mutant females are sterile, and embryos die following the first cleavage. This gene is required for endoplasmic reticulum redistribution and calcium homeostasis in oocytes. In addition, ovulated oocytes mutant for this gene have abnormal mitochondrial localization and increased mitochondrial activity, which results in mitochondrial damage and early embryonic lethality. Pseudogenes of this gene have been found on chromosomes 7 and 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Females lacking this maternal effect gene are sterile. Preimplantation embryos do not develop past the 2-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs C A 5: 125,514,977 N576K probably benign Het
Abca5 G T 11: 110,299,978 L769M probably damaging Het
Abca5 T A 11: 110,299,986 H766L possibly damaging Het
Acvr1c A G 2: 58,287,884 I191T probably damaging Het
Agps A T 2: 75,866,779 E314D probably damaging Het
Agxt G A 1: 93,135,768 G131R probably damaging Het
Ak8 A G 2: 28,742,746 T326A probably benign Het
Aldoart2 T A 12: 55,566,277 I329N probably benign Het
Apaf1 T C 10: 91,060,185 I342V possibly damaging Het
Arhgap40 T C 2: 158,527,161 S68P probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AU022252 C T 4: 119,228,097 R71Q possibly damaging Het
Baz1b T C 5: 135,217,782 L695P probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Cep76 T C 18: 67,624,958 M421V probably benign Het
Clk2 A G 3: 89,168,703 D60G probably damaging Het
Clstn3 G T 6: 124,462,169 T6K probably damaging Het
Cluap1 T A 16: 3,919,558 D180E probably benign Het
Col12a1 T C 9: 79,699,552 I530V probably benign Het
Cpt1a T C 19: 3,365,788 probably benign Het
Cr2 T G 1: 195,155,272 K797Q possibly damaging Het
Crybg3 C A 16: 59,554,112 V2260L probably benign Het
Csnk1a1 T A 18: 61,585,250 probably benign Het
Cxcr1 T C 1: 74,192,770 D31G probably benign Het
Cyp2a5 G T 7: 26,835,936 D108Y probably damaging Het
Dnajc1 A G 2: 18,222,727 V376A possibly damaging Het
Eif4enif1 T C 11: 3,236,278 V462A probably benign Het
Elmo1 A G 13: 20,290,477 K357R possibly damaging Het
Eml6 T A 11: 29,818,374 H771L probably damaging Het
Epb41l4a A G 18: 33,832,664 I370T probably benign Het
Esp36 A T 17: 38,417,281 N79K possibly damaging Het
Fam229b A G 10: 39,118,919 *81Q probably null Het
Fat4 T C 3: 38,983,076 Y3626H probably damaging Het
Fbn1 A T 2: 125,306,285 F2681Y probably benign Het
Gad1-ps A G 10: 99,445,469 noncoding transcript Het
Galm C A 17: 80,183,267 N284K probably damaging Het
Gtf3c2 A T 5: 31,159,102 S735T probably benign Het
Hsph1 A T 5: 149,630,383 S207T probably benign Het
Il33 C T 19: 29,955,215 R159C probably damaging Het
Invs A G 4: 48,382,148 N106S possibly damaging Het
Kif21b G T 1: 136,169,324 probably null Het
Kirrel2 A G 7: 30,456,498 C42R probably damaging Het
Letm1 A C 5: 33,752,555 C378W probably damaging Het
Lrrc71 T A 3: 87,745,484 K160N probably benign Het
Lrrtm3 A G 10: 64,089,025 I121T probably damaging Het
Lztr1 T A 16: 17,509,670 V79E probably damaging Het
Mmp8 T G 9: 7,566,278 D378E probably damaging Het
Mpzl3 A G 9: 45,066,529 E145G probably damaging Het
Mrps2 C T 2: 28,469,664 L178F probably damaging Het
Mzb1 A G 18: 35,647,822 probably null Het
Nckap1 T C 2: 80,553,415 D135G probably damaging Het
Ndst1 A G 18: 60,697,170 F623L possibly damaging Het
Olfr1225 A G 2: 89,170,937 S92P probably damaging Het
Olfr1241 T C 2: 89,482,248 M296V probably null Het
Olfr1311 A G 2: 112,021,404 V150A probably benign Het
Olfr146 T C 9: 39,019,025 D172G probably benign Het
Olfr307 T C 7: 86,336,345 D17G possibly damaging Het
Olfr32 A G 2: 90,138,404 V245A probably benign Het
Olfr548-ps1 T C 7: 102,542,125 L63P probably damaging Het
Olfr907 A G 9: 38,498,818 I50V probably benign Het
Parp14 T G 16: 35,857,224 E791D probably benign Het
Pcdh8 C T 14: 79,769,389 R578H possibly damaging Het
Phrf1 T A 7: 141,259,801 probably benign Het
Polr3b C A 10: 84,680,385 H626N probably benign Het
Ppp1r12a A G 10: 108,251,859 T58A probably benign Het
Ppp4r3b T A 11: 29,182,460 V33D probably damaging Het
Ppp5c A G 7: 17,009,982 Y176H probably damaging Het
R3hdm1 A G 1: 128,197,005 Y343C probably damaging Het
Rabac1 C T 7: 24,972,130 V122M probably damaging Het
Rasef G T 4: 73,735,748 Q561K probably damaging Het
Rbl1 A G 2: 157,195,634 S198P probably damaging Het
Rbm12 A T 2: 156,097,536 M272K probably damaging Het
Rexo1 T G 10: 80,550,050 K391N possibly damaging Het
Rnf43 T C 11: 87,731,347 S384P probably benign Het
Rpsa A T 9: 120,131,000 I210F possibly damaging Het
Rslcan18 A G 13: 67,098,952 Y75H possibly damaging Het
Scn9a T A 2: 66,526,813 D1048V probably benign Het
Sec11a T C 7: 80,927,734 probably null Het
Sidt2 A G 9: 45,950,089 V19A probably damaging Het
Snx14 G A 9: 88,398,364 Q522* probably null Het
Stx1b A G 7: 127,814,972 L74S probably damaging Het
Tm7sf3 A T 6: 146,609,878 M371K probably benign Het
Tmem115 T C 9: 107,534,975 V166A probably benign Het
Traf5 T A 1: 191,999,951 T310S probably benign Het
Trdn A G 10: 33,466,452 K619E probably benign Het
Trmt10a T A 3: 138,152,184 probably null Het
Txk A C 5: 72,707,671 I287R probably damaging Het
Txndc16 T C 14: 45,151,887 D452G probably damaging Het
Ube2f G A 1: 91,262,301 probably null Het
Ubtfl1 T G 9: 18,410,193 I339R probably benign Het
Upf1 A G 8: 70,338,505 I529T probably damaging Het
Vmn1r197 A G 13: 22,328,653 D248G possibly damaging Het
Vmn1r5 A T 6: 56,985,786 T149S probably benign Het
Vmn1r83 C T 7: 12,321,270 V287I possibly damaging Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vmn2r-ps130 A G 17: 23,063,801 T152A probably benign Het
Vps13b T C 15: 35,839,975 F2448L probably damaging Het
Vps13b A G 15: 35,841,573 N2583S probably benign Het
Wscd1 C T 11: 71,788,675 P458L probably damaging Het
Xylt2 T A 11: 94,670,433 D168V probably damaging Het
Zdhhc2 A G 8: 40,467,972 T306A probably benign Het
Zfp804b A T 5: 6,769,771 D1097E possibly damaging Het
Zfp93 T A 7: 24,275,731 C380* probably null Het
Zfp960 T A 17: 17,088,256 C411S probably damaging Het
Zmynd15 T A 11: 70,464,793 V430E probably damaging Het
Other mutations in Nlrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Nlrp5 APN 7 23441788 missense probably damaging 1.00
IGL01393:Nlrp5 APN 7 23404174 missense probably null 0.04
IGL01505:Nlrp5 APN 7 23417734 missense probably benign 0.15
IGL02010:Nlrp5 APN 7 23417372 missense probably benign 0.04
IGL02223:Nlrp5 APN 7 23430022 splice site probably benign
IGL02341:Nlrp5 APN 7 23404152 missense probably benign 0.43
IGL02532:Nlrp5 APN 7 23409973 missense possibly damaging 0.70
IGL02619:Nlrp5 APN 7 23424064 critical splice donor site probably null
IGL02659:Nlrp5 APN 7 23418581 missense probably damaging 1.00
IGL02828:Nlrp5 APN 7 23421460 missense possibly damaging 0.81
IGL03018:Nlrp5 APN 7 23417747 missense probably benign 0.06
IGL03164:Nlrp5 APN 7 23418373 nonsense probably null
IGL03397:Nlrp5 APN 7 23413334 missense probably damaging 1.00
IGL03404:Nlrp5 APN 7 23430034 missense probably benign 0.00
R0310:Nlrp5 UTSW 7 23430157 missense probably damaging 0.99
R0549:Nlrp5 UTSW 7 23441802 missense probably damaging 1.00
R0573:Nlrp5 UTSW 7 23417631 missense probably damaging 1.00
R0647:Nlrp5 UTSW 7 23417707 missense probably damaging 1.00
R0675:Nlrp5 UTSW 7 23417417 missense possibly damaging 0.53
R0826:Nlrp5 UTSW 7 23417708 missense probably benign 0.13
R1620:Nlrp5 UTSW 7 23418639 missense probably damaging 1.00
R1858:Nlrp5 UTSW 7 23418161 missense probably damaging 0.98
R1867:Nlrp5 UTSW 7 23423982 missense possibly damaging 0.85
R1887:Nlrp5 UTSW 7 23417484 missense probably damaging 1.00
R1899:Nlrp5 UTSW 7 23404797 missense probably benign 0.00
R1901:Nlrp5 UTSW 7 23423910 missense possibly damaging 0.94
R2032:Nlrp5 UTSW 7 23421512 missense probably damaging 1.00
R3083:Nlrp5 UTSW 7 23430163 missense probably benign 0.03
R3806:Nlrp5 UTSW 7 23404846 missense probably benign
R3907:Nlrp5 UTSW 7 23433646 missense possibly damaging 0.48
R4085:Nlrp5 UTSW 7 23430098 missense probably damaging 0.97
R4135:Nlrp5 UTSW 7 23418398 missense possibly damaging 0.92
R4609:Nlrp5 UTSW 7 23417748 missense probably benign 0.01
R4649:Nlrp5 UTSW 7 23418178 missense probably damaging 1.00
R4780:Nlrp5 UTSW 7 23435778 missense probably damaging 1.00
R4793:Nlrp5 UTSW 7 23417630 missense probably damaging 0.97
R5062:Nlrp5 UTSW 7 23435910 nonsense probably null
R5224:Nlrp5 UTSW 7 23417976 missense probably damaging 1.00
R5364:Nlrp5 UTSW 7 23418328 nonsense probably null
R5426:Nlrp5 UTSW 7 23418201 missense probably damaging 1.00
R5488:Nlrp5 UTSW 7 23417934 missense probably benign 0.03
R5762:Nlrp5 UTSW 7 23418839 missense possibly damaging 0.89
R6014:Nlrp5 UTSW 7 23409947 missense probably benign 0.02
R6130:Nlrp5 UTSW 7 23404173 missense probably benign 0.00
R6277:Nlrp5 UTSW 7 23421455 missense probably damaging 1.00
R6509:Nlrp5 UTSW 7 23417916 missense probably damaging 1.00
R6519:Nlrp5 UTSW 7 23417918 missense probably benign 0.22
R7042:Nlrp5 UTSW 7 23417480 missense possibly damaging 0.52
R7253:Nlrp5 UTSW 7 23417391 missense possibly damaging 0.93
R7336:Nlrp5 UTSW 7 23417634 missense probably damaging 0.98
R7371:Nlrp5 UTSW 7 23418423 missense probably damaging 0.99
R7449:Nlrp5 UTSW 7 23417526 missense probably benign 0.00
R7505:Nlrp5 UTSW 7 23407500 missense probably benign 0.01
R7580:Nlrp5 UTSW 7 23433749 missense probably damaging 1.00
R7588:Nlrp5 UTSW 7 23408151 missense probably benign 0.21
R7793:Nlrp5 UTSW 7 23423918 missense possibly damaging 0.87
R7795:Nlrp5 UTSW 7 23418794 missense possibly damaging 0.78
R7893:Nlrp5 UTSW 7 23418165 missense probably benign 0.12
R8071:Nlrp5 UTSW 7 23418444 missense probably damaging 1.00
R8170:Nlrp5 UTSW 7 23433710 missense probably benign 0.17
R8195:Nlrp5 UTSW 7 23413337 missense probably benign 0.00
R8212:Nlrp5 UTSW 7 23417337 missense probably benign 0.02
R8232:Nlrp5 UTSW 7 23417345 missense probably benign 0.00
R8743:Nlrp5 UTSW 7 23418747 missense probably benign 0.28
R8853:Nlrp5 UTSW 7 23418300 missense possibly damaging 0.94
RF007:Nlrp5 UTSW 7 23418161 missense probably benign 0.16
U24488:Nlrp5 UTSW 7 23418228 missense possibly damaging 0.94
X0026:Nlrp5 UTSW 7 23417498 nonsense probably null
X0062:Nlrp5 UTSW 7 23417990 nonsense probably null
Z1088:Nlrp5 UTSW 7 23404167 missense possibly damaging 0.82
Z1088:Nlrp5 UTSW 7 23417586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGCAGAGGACATGCTTCTAC -3'
(R):5'- AGCCACATGGCTCTGTCTGTGATG -3'

Sequencing Primer
(F):5'- tgtcctgatcttgcacagatag -3'
(R):5'- GTTCATCCCCATGACTCACAGG -3'
Posted On2014-04-13