Incidental Mutation 'R1629:Khdc1a'
ID 172651
Institutional Source Beutler Lab
Gene Symbol Khdc1a
Ensembl Gene ENSMUSG00000067750
Gene Name KH domain containing 1A
Synonyms Ndg1
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R1629 (G1)
Quality Score 108
Status Not validated
Chromosome 1
Chromosomal Location 21349641-21352200 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21350897 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 102 (I102N)
Ref Sequence ENSEMBL: ENSMUSP00000085749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088407]
AlphaFold Q3UWR2
Predicted Effect possibly damaging
Transcript: ENSMUST00000088407
AA Change: I102N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085749
Gene: ENSMUSG00000067750
AA Change: I102N

Pfam:MOEP19 6 92 3.2e-25 PFAM
transmembrane domain 136 158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148174
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Khdc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Khdc1a APN 1 21350988 missense probably benign 0.00
R1169:Khdc1a UTSW 1 21350271 missense possibly damaging 0.51
R1389:Khdc1a UTSW 1 21350027 missense probably damaging 0.98
R1432:Khdc1a UTSW 1 21350318 missense possibly damaging 0.85
R1735:Khdc1a UTSW 1 21350965 missense probably benign 0.00
R2064:Khdc1a UTSW 1 21350972 missense probably benign 0.00
R2065:Khdc1a UTSW 1 21350972 missense probably benign 0.00
R4398:Khdc1a UTSW 1 21350393 missense possibly damaging 0.45
R4575:Khdc1a UTSW 1 21350429 missense probably damaging 0.97
R6030:Khdc1a UTSW 1 21350884 missense probably benign 0.01
R6030:Khdc1a UTSW 1 21350884 missense probably benign 0.01
R6183:Khdc1a UTSW 1 21350108 missense possibly damaging 0.80
R7492:Khdc1a UTSW 1 21350318 missense possibly damaging 0.93
R7861:Khdc1a UTSW 1 21350399 missense possibly damaging 0.52
R7982:Khdc1a UTSW 1 21350906 missense probably benign 0.15
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgctgggaattgaaatttggac -3'
Posted On 2014-04-24