Mutagenetix > Incidental Mutation

Incidental Mutation 'R1629:Vmn2r23'

172672

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

039666-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R1629 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 123713427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 421 (S421T)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

probably benign
Transcript: ENSMUST00000172391
AA Change: S421T

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: S421T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	A	C	18: 58,954,619	I574L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
BC005624	T	C	2: 30,974,008	E191G	probably damaging	Het
Cbx2	A	G	11: 119,028,980	D457G	probably damaging	Het
Ccdc110	A	G	8: 45,942,127	K352E	probably benign	Het
Cdk14	A	T	5: 5,103,807	H183Q	probably benign	Het
Cfap58	A	G	19: 47,941,339	T80A	probably benign	Het
Cftr	C	T	6: 18,226,106	T351I	probably damaging	Het
Col27a1	A	G	4: 63,329,863		probably benign	Het
Cp	T	A	3: 19,966,450		probably null	Het
Cpne8	A	T	15: 90,571,972	V196E	probably benign	Het
Dmxl1	T	G	18: 49,859,286		probably null	Het
Dnm2	T	A	9: 21,504,458	L642Q	probably damaging	Het
Dock2	G	T	11: 34,262,480		probably null	Het
Dock9	A	G	14: 121,543,574	F2091L	possibly damaging	Het
Eaf2	A	G	16: 36,824,701	V53A	probably damaging	Het
Fam208b	T	C	13: 3,574,121	H1943R	possibly damaging	Het
Fbl	G	T	7: 28,174,787		probably benign	Het
Fbn2	T	C	18: 58,026,538	D2373G	probably damaging	Het
Gbp2b	A	G	3: 142,610,974	Y462C	possibly damaging	Het
Il1rl2	T	A	1: 40,356,860	F348I	probably benign	Het
Khdc1a	T	A	1: 21,350,897	I102N	possibly damaging	Het
Klhl11	T	C	11: 100,464,186	T270A	probably benign	Het
Lama1	T	C	17: 67,805,428	S2288P	probably benign	Het
Lrfn4	T	C	19: 4,613,495	E337G	possibly damaging	Het
Macf1	C	A	4: 123,508,415	E549*	probably null	Het
Mmp3	G	T	9: 7,447,641	V209F	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myh9	G	A	15: 77,764,401	R1725W	probably damaging	Het
Nbea	A	T	3: 56,002,891	D1294E	possibly damaging	Het
Nrcam	G	A	12: 44,563,986	A496T	probably benign	Het
Nufip2	A	G	11: 77,693,008	T583A	probably benign	Het
Olfr1033	A	G	2: 86,041,422	T36A	probably damaging	Het
Ppig	C	A	2: 69,735,873	T128K	probably damaging	Het
Ppp2r2a	A	T	14: 67,019,759	C341S	possibly damaging	Het
Ptpre	A	T	7: 135,669,799	D374V	probably damaging	Het
Ranbp3l	A	C	15: 9,064,988	Q485P	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Slc1a7	A	G	4: 108,008,143	Y276C	probably damaging	Het
Smarcad1	A	G	6: 65,067,107	D221G	probably benign	Het
Smn1	C	A	13: 100,127,896	T45N	probably damaging	Het
Son	T	C	16: 91,657,622	S1086P	probably damaging	Het
Ssmem1	T	A	6: 30,512,492	Y45N	possibly damaging	Het
Tmem184c	A	C	8: 77,602,922	F170V	possibly damaging	Het
Tmem184c	A	T	8: 77,606,162		probably null	Het
Vmn1r59	C	T	7: 5,454,467	C98Y	probably damaging	Het
Vmn2r98	T	C	17: 19,067,383	S493P	possibly damaging	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CATATTTTGAACAGCATGGGATCAGGGA -3'
(R):5'- CCAAGCTACTGCATCAAATGTGGCTAA -3'

Sequencing Primer
(F):5'- TCAGGGAACTGAGTCAATGTG -3'
(R):5'- CTGCATCAAATGTGGCTAAAATCC -3'

Posted On

2014-04-24