Mutagenetix > Incidental Mutations

Incidental Mutation 'R1602:Arfgef1'

176185

Institutional Source

Beutler Lab

Gene Symbol

Arfgef1

Ensembl Gene

ENSMUSG00000067851

Gene Name

ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)

Synonyms

P200, ARFGEP1, BIG1, D130059B05Rik, D730028O18Rik

MMRRC Submission

039639-MU

Accession Numbers

Genbank: NM_001102430.1

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1602 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10137571-10232670 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 10204890 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 312 (I312M)

Ref Sequence

ENSEMBL: ENSMUSP00000118805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088615] [ENSMUST00000131556]

Predicted Effect

probably benign
Transcript: ENSMUST00000088615
AA Change: I312M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000085986
Gene: ENSMUSG00000067851
AA Change: I312M

Domain	Start	End	E-Value	Type
Pfam:DCB	28	213	5.2e-45	PFAM
low complexity region	221	233	N/A	INTRINSIC
low complexity region	291	306	N/A	INTRINSIC
Pfam:Sec7_N	416	575	1.3e-52	PFAM
Blast:Sec7	588	637	6e-24	BLAST
low complexity region	661	681	N/A	INTRINSIC
Sec7	692	879	1.15e-105	SMART
Blast:Sec7	897	933	6e-13	BLAST
Blast:Sec7	947	986	8e-18	BLAST
Pfam:DUF1981	1217	1300	3.6e-39	PFAM
low complexity region	1587	1602	N/A	INTRINSIC
low complexity region	1777	1782	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000131556
AA Change: I312M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000118805
Gene: ENSMUSG00000067851
AA Change: I312M

Domain	Start	End	E-Value	Type
coiled coil region	207	234	N/A	INTRINSIC
low complexity region	291	306	N/A	INTRINSIC
Pfam:Sec7_N	413	576	3.1e-59	PFAM
Blast:Sec7	588	637	2e-24	BLAST
low complexity region	661	681	N/A	INTRINSIC
Sec7	692	879	1.15e-105	SMART
Blast:Sec7	897	933	3e-13	BLAST
Blast:Sec7	947	986	2e-18	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186720

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186813

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.4%

Validation Efficiency

91% (49/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP. It contains a Sec7 domain, which may be responsible for guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, absent gastric milk and decreased brain size with increased neuron apoptosis, abnormal axon guidance and hypersensitivity to glutamate. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd12	A	T	17: 65,983,688	Y1583*	probably null	Het
Ankrd34c	T	C	9: 89,729,005	T428A	possibly damaging	Het
Atr	T	C	9: 95,951,557	L2620P	probably damaging	Het
Ccdc110	A	G	8: 45,938,918	Y54C	probably benign	Het
Cecr2	T	C	6: 120,755,587	V480A	possibly damaging	Het
Chfr	A	G	5: 110,151,665	D308G	probably benign	Het
Cit	T	A	5: 115,997,730	I1919N	probably damaging	Het
Ctsc	T	A	7: 88,278,304	D34E	possibly damaging	Het
Diaph3	T	A	14: 87,091,158		probably benign	Het
Dnah6	T	A	6: 73,067,469	I3220F	probably damaging	Het
Elmod3	A	G	6: 72,569,259		probably null	Het
Fam35a	A	G	14: 34,267,650	I433T	probably damaging	Het
Fgd5	T	C	6: 92,066,184	V1215A	possibly damaging	Het
Filip1	T	C	9: 79,820,591	M249V	probably damaging	Het
Fmn1	C	T	2: 113,525,623	P803L	unknown	Het
Gcfc2	A	G	6: 81,944,420	K469R	probably damaging	Het
Gm12169	T	C	11: 46,535,588	I174T	probably benign	Het
Gm6803	C	A	12: 88,018,364	E136D	probably benign	Het
Gm8994	G	A	6: 136,328,780	A80T	probably damaging	Het
Itgad	A	G	7: 128,190,939	T637A	probably damaging	Het
Kank2	T	C	9: 21,769,837	S799G	probably damaging	Het
Kcnc4	A	T	3: 107,448,204	D309E	possibly damaging	Het
Lamc2	G	A	1: 153,127,028	T1069M	probably benign	Het
Lepr	T	A	4: 101,745,645	M210K	possibly damaging	Het
Lig3	T	C	11: 82,792,194		probably null	Het
Oat	G	T	7: 132,570,007	T33K	probably benign	Het
Olfr1356	T	A	10: 78,846,968	M316L	probably benign	Het
Olfr1368	T	C	13: 21,142,650	M136V	probably damaging	Het
Olfr32	A	G	2: 90,139,055	F28S	probably damaging	Het
Pcnx3	G	T	19: 5,672,515	A1383E	probably damaging	Het
Pctp	T	C	11: 89,988,735	Y100C	probably damaging	Het
Pex6	G	T	17: 46,712,137	R213L	probably benign	Het
Phlpp2	T	C	8: 109,934,023	L770S	possibly damaging	Het
Pkn2	A	T	3: 142,853,538	D75E	possibly damaging	Het
Pla2g12b	T	C	10: 59,421,553		probably null	Het
Plch2	C	T	4: 154,984,450	V1135I	probably damaging	Het
Pskh1	T	A	8: 105,912,821	S44R	probably benign	Het
Ptpa	G	T	2: 30,437,590	A119S	probably benign	Het
Slfn3	A	G	11: 83,212,715	I137M	probably damaging	Het
St6galnac1	A	T	11: 116,769,287	S67T	probably benign	Het
Treml1	A	G	17: 48,364,889	E137G	probably damaging	Het
Ubr2	A	C	17: 46,941,061	C1518G	probably benign	Het
Vmn2r55	A	T	7: 12,652,644	C470S	probably damaging	Het

Other mutations in Arfgef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Arfgef1	APN	1	10199787	missense	probably benign
IGL00919:Arfgef1	APN	1	10173237	missense	probably damaging	1.00
IGL01022:Arfgef1	APN	1	10174076	missense	probably damaging	1.00
IGL01155:Arfgef1	APN	1	10198982	splice site	probably benign
IGL01288:Arfgef1	APN	1	10213211	missense	possibly damaging	0.67
IGL01397:Arfgef1	APN	1	10159571	missense	probably benign	0.40
IGL01433:Arfgef1	APN	1	10153432	missense	probably damaging	1.00
IGL01653:Arfgef1	APN	1	10159908	nonsense	probably null
IGL01669:Arfgef1	APN	1	10159615	missense	probably damaging	1.00
IGL01795:Arfgef1	APN	1	10147528	missense	probably benign	0.01
IGL01860:Arfgef1	APN	1	10154396	missense	probably damaging	1.00
IGL02137:Arfgef1	APN	1	10213113	missense	probably damaging	1.00
IGL02365:Arfgef1	APN	1	10199883	missense	probably benign	0.00
IGL02519:Arfgef1	APN	1	10209668	missense	probably benign	0.13
IGL02542:Arfgef1	APN	1	10172842	missense	probably benign	0.24
IGL02604:Arfgef1	APN	1	10181050	splice site	probably benign
IGL02743:Arfgef1	APN	1	10199829	missense	probably benign	0.00
IGL03225:Arfgef1	APN	1	10154318	missense	probably damaging	1.00
Collected	UTSW	1	10180938	missense	probably damaging	1.00
uncle_joe	UTSW	1	10160835	missense	probably damaging	1.00
G1Funyon:Arfgef1	UTSW	1	10179833	missense	probably damaging	1.00
I2288:Arfgef1	UTSW	1	10173253	missense	probably damaging	1.00
I2289:Arfgef1	UTSW	1	10173253	missense	probably damaging	1.00
R0383:Arfgef1	UTSW	1	10198842	critical splice donor site	probably null
R0491:Arfgef1	UTSW	1	10179987	splice site	probably benign
R0636:Arfgef1	UTSW	1	10199851	missense	probably benign
R1006:Arfgef1	UTSW	1	10140481	missense	probably benign	0.00
R1212:Arfgef1	UTSW	1	10216559	missense	probably benign	0.05
R1233:Arfgef1	UTSW	1	10184090	missense	probably damaging	1.00
R1346:Arfgef1	UTSW	1	10159733	missense	probably benign	0.41
R1416:Arfgef1	UTSW	1	10172939	missense	probably damaging	1.00
R1477:Arfgef1	UTSW	1	10189284	missense	probably damaging	1.00
R1581:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R1587:Arfgef1	UTSW	1	10159959	missense	probably damaging	0.99
R1745:Arfgef1	UTSW	1	10173255	missense	probably damaging	1.00
R1831:Arfgef1	UTSW	1	10204890	missense	probably benign	0.01
R1832:Arfgef1	UTSW	1	10204890	missense	probably benign	0.01
R1833:Arfgef1	UTSW	1	10204890	missense	probably benign	0.01
R1918:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R1919:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R2059:Arfgef1	UTSW	1	10188752	splice site	probably null
R2146:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R2148:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R2149:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R2150:Arfgef1	UTSW	1	10199878	missense	probably benign	0.02
R2373:Arfgef1	UTSW	1	10174142	missense	probably damaging	1.00
R2516:Arfgef1	UTSW	1	10153654	missense	possibly damaging	0.89
R3863:Arfgef1	UTSW	1	10142586	frame shift	probably null
R3916:Arfgef1	UTSW	1	10189443	missense	probably benign	0.01
R3948:Arfgef1	UTSW	1	10142586	frame shift	probably null
R3949:Arfgef1	UTSW	1	10142586	frame shift	probably null
R3977:Arfgef1	UTSW	1	10209634	missense	probably benign	0.01
R3978:Arfgef1	UTSW	1	10209634	missense	probably benign	0.01
R3979:Arfgef1	UTSW	1	10209634	missense	probably benign	0.01
R4086:Arfgef1	UTSW	1	10163759	missense	probably benign	0.06
R4175:Arfgef1	UTSW	1	10159636	missense	probably damaging	1.00
R4257:Arfgef1	UTSW	1	10159546	intron	probably benign
R4572:Arfgef1	UTSW	1	10213141	missense	probably damaging	1.00
R4652:Arfgef1	UTSW	1	10173262	missense	probably damaging	0.98
R4678:Arfgef1	UTSW	1	10142666	missense	probably benign	0.03
R4737:Arfgef1	UTSW	1	10189611	missense	possibly damaging	0.85
R4779:Arfgef1	UTSW	1	10153733	missense	probably damaging	1.00
R4818:Arfgef1	UTSW	1	10216547	missense	probably benign
R4898:Arfgef1	UTSW	1	10159573	missense	possibly damaging	0.75
R4979:Arfgef1	UTSW	1	10213109	missense	probably damaging	1.00
R5039:Arfgef1	UTSW	1	10199736	missense	probably benign	0.37
R5194:Arfgef1	UTSW	1	10204907	missense	probably benign	0.09
R5428:Arfgef1	UTSW	1	10160835	missense	probably damaging	1.00
R5533:Arfgef1	UTSW	1	10199727	critical splice donor site	probably null
R5547:Arfgef1	UTSW	1	10160976	missense	probably damaging	1.00
R5562:Arfgef1	UTSW	1	10144746	missense	probably damaging	1.00
R5635:Arfgef1	UTSW	1	10188860	missense	possibly damaging	0.81
R5697:Arfgef1	UTSW	1	10160838	missense	probably benign	0.03
R5704:Arfgef1	UTSW	1	10159583	missense	probably damaging	0.98
R5722:Arfgef1	UTSW	1	10138884	missense	probably benign	0.04
R5793:Arfgef1	UTSW	1	10209528	missense	probably benign	0.01
R5835:Arfgef1	UTSW	1	10160739	missense	probably damaging	1.00
R5870:Arfgef1	UTSW	1	10180938	missense	probably damaging	1.00
R5990:Arfgef1	UTSW	1	10172921	missense	probably damaging	0.99
R6290:Arfgef1	UTSW	1	10188811	missense	possibly damaging	0.91
R6460:Arfgef1	UTSW	1	10213060	missense	probably damaging	1.00
R6613:Arfgef1	UTSW	1	10194396	missense	possibly damaging	0.95
R6802:Arfgef1	UTSW	1	10189452	missense	probably benign	0.35
R6967:Arfgef1	UTSW	1	10153678	missense	probably damaging	1.00
R6967:Arfgef1	UTSW	1	10153679	missense	probably damaging	0.99
R6968:Arfgef1	UTSW	1	10153678	missense	probably damaging	1.00
R6968:Arfgef1	UTSW	1	10153679	missense	probably damaging	0.99
R6969:Arfgef1	UTSW	1	10153678	missense	probably damaging	1.00
R6969:Arfgef1	UTSW	1	10153679	missense	probably damaging	0.99
R6970:Arfgef1	UTSW	1	10153678	missense	probably damaging	1.00
R6970:Arfgef1	UTSW	1	10153679	missense	probably damaging	0.99
R7092:Arfgef1	UTSW	1	10153676	missense	probably damaging	1.00
R7251:Arfgef1	UTSW	1	10198975	missense	possibly damaging	0.81
R7334:Arfgef1	UTSW	1	10184460	missense	probably damaging	1.00
R7399:Arfgef1	UTSW	1	10180897	missense	probably benign	0.00
R7631:Arfgef1	UTSW	1	10232469	missense	probably benign	0.00
R7699:Arfgef1	UTSW	1	10194411	missense	possibly damaging	0.78
R7700:Arfgef1	UTSW	1	10194411	missense	possibly damaging	0.78
R7772:Arfgef1	UTSW	1	10157010	missense	possibly damaging	0.96
R7968:Arfgef1	UTSW	1	10172920	missense	probably damaging	1.00
R8195:Arfgef1	UTSW	1	10173253	missense	probably damaging	1.00
R8292:Arfgef1	UTSW	1	10156969	missense	probably benign	0.06
R8301:Arfgef1	UTSW	1	10179833	missense	probably damaging	1.00
R8341:Arfgef1	UTSW	1	10154328	missense	probably benign	0.37
R8410:Arfgef1	UTSW	1	10159642	missense	possibly damaging	0.94
R8411:Arfgef1	UTSW	1	10216534	missense	probably benign	0.01
R8793:Arfgef1	UTSW	1	10142607	missense	possibly damaging	0.95
R8903:Arfgef1	UTSW	1	10141613	missense	not run
V1662:Arfgef1	UTSW	1	10173253	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATGTGGCTGACATACACAAACATAC -3'
(R):5'- GTCCCAAGTGGCTCAATATCTGTCTC -3'

Sequencing Primer
(F):5'- GCTGACATACACAAACATACAAACAC -3'
(R):5'- AAGTGGCTCAATATCTGTCTCCTTAG -3'

Posted On

2014-04-24