Incidental Mutation 'R1602:Kank2'
ID176210
Institutional Source Beutler Lab
Gene Symbol Kank2
Ensembl Gene ENSMUSG00000032194
Gene NameKN motif and ankyrin repeat domains 2
SynonymsAnkrd25
MMRRC Submission 039639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R1602 (G1)
Quality Score209
Status Validated
Chromosome9
Chromosomal Location21766784-21798744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21769837 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 799 (S799G)
Ref Sequence ENSEMBL: ENSMUSP00000034717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034717] [ENSMUST00000216008]
Predicted Effect probably damaging
Transcript: ENSMUST00000034717
AA Change: S799G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034717
Gene: ENSMUSG00000032194
AA Change: S799G

DomainStartEndE-ValueType
Pfam:KN_motif 31 69 9.6e-26 PFAM
low complexity region 139 157 N/A INTRINSIC
coiled coil region 213 229 N/A INTRINSIC
coiled coil region 284 316 N/A INTRINSIC
low complexity region 324 343 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
ANK 658 688 6.36e-3 SMART
ANK 692 725 7.29e2 SMART
ANK 730 759 4.97e-5 SMART
ANK 763 793 3.85e-2 SMART
ANK 797 825 1.06e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216008
Meta Mutation Damage Score 0.1927 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KN motif and ankyrin repeat domains (KANK) family of proteins, which play a role in cytoskeletal formation by regulating actin polymerization. The encoded protein functions in the sequestration of steroid receptor coactivators and possibly other proteins. Mutations in this gene are associated with impaired kidney podocyte function and nephrotic syndrome, and keratoderma and woolly hair. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in Kank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Kank2 APN 9 21780479 splice site probably benign
IGL01574:Kank2 APN 9 21794604 missense probably damaging 1.00
IGL01624:Kank2 APN 9 21780380 missense probably damaging 1.00
IGL02752:Kank2 APN 9 21795033 missense probably damaging 1.00
IGL03116:Kank2 APN 9 21772764 missense probably damaging 0.96
IGL03133:Kank2 APN 9 21795641 missense probably null 0.82
IGL03384:Kank2 APN 9 21774578 missense possibly damaging 0.82
PIT4515001:Kank2 UTSW 9 21794883 missense probably benign
R0054:Kank2 UTSW 9 21774674 nonsense probably null
R0480:Kank2 UTSW 9 21779899 missense probably damaging 1.00
R1270:Kank2 UTSW 9 21772760 missense probably damaging 1.00
R1538:Kank2 UTSW 9 21774631 missense probably damaging 0.99
R1574:Kank2 UTSW 9 21774575 missense probably damaging 1.00
R1574:Kank2 UTSW 9 21774575 missense probably damaging 1.00
R1827:Kank2 UTSW 9 21795465 missense probably damaging 1.00
R1941:Kank2 UTSW 9 21772866 missense possibly damaging 0.69
R1976:Kank2 UTSW 9 21794561 missense probably damaging 0.97
R2276:Kank2 UTSW 9 21769784 missense probably damaging 1.00
R2278:Kank2 UTSW 9 21769784 missense probably damaging 1.00
R2303:Kank2 UTSW 9 21769765 missense probably benign 0.12
R4085:Kank2 UTSW 9 21795119 missense probably damaging 1.00
R4163:Kank2 UTSW 9 21795568 missense probably damaging 1.00
R4204:Kank2 UTSW 9 21795627 missense probably damaging 1.00
R4461:Kank2 UTSW 9 21794745 nonsense probably null
R4738:Kank2 UTSW 9 21774619 missense probably damaging 1.00
R4811:Kank2 UTSW 9 21775747 missense probably damaging 1.00
R4859:Kank2 UTSW 9 21779782 missense probably benign 0.13
R5838:Kank2 UTSW 9 21795393 missense probably damaging 0.99
R6449:Kank2 UTSW 9 21780562 missense possibly damaging 0.68
R7131:Kank2 UTSW 9 21794679 missense probably benign 0.02
Z1177:Kank2 UTSW 9 21795249 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAATCCTGGCCTGCCCAAAC -3'
(R):5'- TGCATGTGAGCACGGACACAAG -3'

Sequencing Primer
(F):5'- cctgctgccaagtcatacc -3'
(R):5'- CACAAGGAGATCACCGGGC -3'
Posted On2014-04-24