Mutagenetix > Incidental Mutation

Incidental Mutation 'R1602:Fgd5'

176200

Institutional Source

Beutler Lab

Gene Symbol

Fgd5

Ensembl Gene

ENSMUSG00000034037

Gene Name

FYVE, RhoGEF and PH domain containing 5

Synonyms

C330025N11Rik, ZFYVE23

MMRRC Submission

039639-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R1602 (G1)

Quality Score

203

Status

Validated

Chromosome

Chromosomal Location

91978878-92076004 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92066184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1215 (V1215A)

Ref Sequence

ENSEMBL: ENSMUSP00000086748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089334] [ENSMUST00000113466]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089334
AA Change: V1215A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000086748
Gene: ENSMUSG00000034037
AA Change: V1215A

Domain	Start	End	E-Value	Type
low complexity region	7	16	N/A	INTRINSIC
internal_repeat_1	126	169	2.6e-7	PROSPERO
internal_repeat_1	164	198	2.6e-7	PROSPERO
low complexity region	201	222	N/A	INTRINSIC
low complexity region	254	269	N/A	INTRINSIC
low complexity region	321	332	N/A	INTRINSIC
low complexity region	426	442	N/A	INTRINSIC
low complexity region	453	475	N/A	INTRINSIC
low complexity region	652	663	N/A	INTRINSIC
low complexity region	695	705	N/A	INTRINSIC
low complexity region	727	736	N/A	INTRINSIC
low complexity region	879	894	N/A	INTRINSIC
low complexity region	914	928	N/A	INTRINSIC
Pfam:RhoGEF	946	1134	2.2e-28	PFAM
PH	1165	1260	4.93e-13	SMART
FYVE	1285	1353	2.51e-16	SMART
low complexity region	1368	1390	N/A	INTRINSIC
PH	1416	1514	2.77e-7	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113466
AA Change: V1057A

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000109093
Gene: ENSMUSG00000034037
AA Change: V1057A

Domain	Start	End	E-Value	Type
low complexity region	43	64	N/A	INTRINSIC
low complexity region	96	111	N/A	INTRINSIC
low complexity region	163	174	N/A	INTRINSIC
low complexity region	268	284	N/A	INTRINSIC
low complexity region	295	317	N/A	INTRINSIC
low complexity region	494	505	N/A	INTRINSIC
low complexity region	537	547	N/A	INTRINSIC
low complexity region	569	578	N/A	INTRINSIC
low complexity region	721	736	N/A	INTRINSIC
low complexity region	756	770	N/A	INTRINSIC
Pfam:RhoGEF	788	976	1.6e-27	PFAM
PH	1007	1102	4.93e-13	SMART
FYVE	1127	1195	2.51e-16	SMART
low complexity region	1210	1232	N/A	INTRINSIC
PH	1258	1356	2.77e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146743

Meta Mutation Damage Score

0.4527

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.4%

Validation Efficiency

91% (49/54)

MGI Phenotype

PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd12	A	T	17: 65,983,688	Y1583*	probably null	Het
Ankrd34c	T	C	9: 89,729,005	T428A	possibly damaging	Het
Arfgef1	G	C	1: 10,204,890	I312M	probably benign	Het
Atr	T	C	9: 95,951,557	L2620P	probably damaging	Het
Ccdc110	A	G	8: 45,938,918	Y54C	probably benign	Het
Cecr2	T	C	6: 120,755,587	V480A	possibly damaging	Het
Chfr	A	G	5: 110,151,665	D308G	probably benign	Het
Cit	T	A	5: 115,997,730	I1919N	probably damaging	Het
Ctsc	T	A	7: 88,278,304	D34E	possibly damaging	Het
Diaph3	T	A	14: 87,091,158		probably benign	Het
Dnah6	T	A	6: 73,067,469	I3220F	probably damaging	Het
Elmod3	A	G	6: 72,569,259		probably null	Het
Fam35a	A	G	14: 34,267,650	I433T	probably damaging	Het
Filip1	T	C	9: 79,820,591	M249V	probably damaging	Het
Fmn1	C	T	2: 113,525,623	P803L	unknown	Het
Gcfc2	A	G	6: 81,944,420	K469R	probably damaging	Het
Gm12169	T	C	11: 46,535,588	I174T	probably benign	Het
Gm6803	C	A	12: 88,018,364	E136D	probably benign	Het
Gm8994	G	A	6: 136,328,780	A80T	probably damaging	Het
Itgad	A	G	7: 128,190,939	T637A	probably damaging	Het
Kank2	T	C	9: 21,769,837	S799G	probably damaging	Het
Kcnc4	A	T	3: 107,448,204	D309E	possibly damaging	Het
Lamc2	G	A	1: 153,127,028	T1069M	probably benign	Het
Lepr	T	A	4: 101,745,645	M210K	possibly damaging	Het
Lig3	T	C	11: 82,792,194		probably null	Het
Oat	G	T	7: 132,570,007	T33K	probably benign	Het
Olfr1356	T	A	10: 78,846,968	M316L	probably benign	Het
Olfr1368	T	C	13: 21,142,650	M136V	probably damaging	Het
Olfr32	A	G	2: 90,139,055	F28S	probably damaging	Het
Pcnx3	G	T	19: 5,672,515	A1383E	probably damaging	Het
Pctp	T	C	11: 89,988,735	Y100C	probably damaging	Het
Pex6	G	T	17: 46,712,137	R213L	probably benign	Het
Phlpp2	T	C	8: 109,934,023	L770S	possibly damaging	Het
Pkn2	A	T	3: 142,853,538	D75E	possibly damaging	Het
Pla2g12b	T	C	10: 59,421,553		probably null	Het
Plch2	C	T	4: 154,984,450	V1135I	probably damaging	Het
Pskh1	T	A	8: 105,912,821	S44R	probably benign	Het
Ptpa	G	T	2: 30,437,590	A119S	probably benign	Het
Slfn3	A	G	11: 83,212,715	I137M	probably damaging	Het
St6galnac1	A	T	11: 116,769,287	S67T	probably benign	Het
Treml1	A	G	17: 48,364,889	E137G	probably damaging	Het
Ubr2	A	C	17: 46,941,061	C1518G	probably benign	Het
Vmn2r55	A	T	7: 12,652,644	C470S	probably damaging	Het

Other mutations in Fgd5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00823:Fgd5	APN	6	91988459	missense	possibly damaging	0.63
IGL01354:Fgd5	APN	6	92061843	nonsense	probably null
IGL01597:Fgd5	APN	6	91987929	missense	probably damaging	1.00
IGL01648:Fgd5	APN	6	91989359	nonsense	probably null
IGL01781:Fgd5	APN	6	91988717	missense	possibly damaging	0.88
IGL01977:Fgd5	APN	6	92024562	missense	probably benign	0.20
IGL02053:Fgd5	APN	6	92053244	missense	probably benign	0.03
IGL02206:Fgd5	APN	6	91987258	utr 5 prime	probably benign
IGL02825:Fgd5	APN	6	92038087	splice site	probably null
IGL02838:Fgd5	APN	6	91987674	missense	probably benign
IGL03126:Fgd5	APN	6	92065164	missense	probably damaging	1.00
IGL03369:Fgd5	APN	6	91988415	missense	probably damaging	1.00
hygeia	UTSW	6	91989300	missense	probably damaging	1.00
Imploded	UTSW	6	92049931	splice site	probably null
R0029:Fgd5	UTSW	6	92067558	missense	probably benign	0.04
R0109:Fgd5	UTSW	6	91988235	missense	possibly damaging	0.74
R0109:Fgd5	UTSW	6	91988235	missense	possibly damaging	0.74
R0212:Fgd5	UTSW	6	91988208	missense	probably damaging	1.00
R1148:Fgd5	UTSW	6	91987631	missense	probably benign
R1148:Fgd5	UTSW	6	91987631	missense	probably benign
R1159:Fgd5	UTSW	6	91988502	missense	probably benign	0.00
R1199:Fgd5	UTSW	6	91986978	missense	possibly damaging	0.87
R1493:Fgd5	UTSW	6	91987631	missense	probably benign
R1953:Fgd5	UTSW	6	92024630	missense	probably benign	0.31
R2280:Fgd5	UTSW	6	91988945	missense	possibly damaging	0.86
R2437:Fgd5	UTSW	6	92062869	nonsense	probably null
R2883:Fgd5	UTSW	6	91987109	splice site	probably null
R4133:Fgd5	UTSW	6	92069437	missense	probably damaging	1.00
R4454:Fgd5	UTSW	6	91989186	missense	probably damaging	1.00
R4491:Fgd5	UTSW	6	91989299	missense	possibly damaging	0.90
R4606:Fgd5	UTSW	6	91988209	missense	possibly damaging	0.67
R4981:Fgd5	UTSW	6	91989300	missense	probably damaging	1.00
R5162:Fgd5	UTSW	6	92074234	missense	probably damaging	1.00
R5525:Fgd5	UTSW	6	92066247	missense	probably damaging	1.00
R5570:Fgd5	UTSW	6	91988687	missense	probably damaging	1.00
R5936:Fgd5	UTSW	6	91987911	missense	probably damaging	0.98
R6012:Fgd5	UTSW	6	91989341	missense	possibly damaging	0.95
R6723:Fgd5	UTSW	6	91988030	missense	probably benign
R6764:Fgd5	UTSW	6	91989421	missense	probably damaging	0.96
R7187:Fgd5	UTSW	6	91988291	missense	possibly damaging	0.54
R7383:Fgd5	UTSW	6	91987118	missense	probably benign	0.01
R7418:Fgd5	UTSW	6	92024538	missense	probably benign	0.11
R7662:Fgd5	UTSW	6	92049931	splice site	probably null
R7788:Fgd5	UTSW	6	91988459	missense	possibly damaging	0.63
R7882:Fgd5	UTSW	6	92068478	missense	probably damaging	1.00
R7895:Fgd5	UTSW	6	91987281	missense	probably benign	0.03
R8041:Fgd5	UTSW	6	92061856	missense	probably damaging	0.98
R8053:Fgd5	UTSW	6	91989444	missense	probably benign	0.34
R8176:Fgd5	UTSW	6	91987984	missense	probably benign	0.13
R8243:Fgd5	UTSW	6	91989023	missense	possibly damaging	0.93
R8318:Fgd5	UTSW	6	91987496	missense	probably benign	0.17
R8772:Fgd5	UTSW	6	92050419	missense	probably damaging	0.99
R8804:Fgd5	UTSW	6	91987526	missense	probably benign
R9036:Fgd5	UTSW	6	92069466	nonsense	probably null
R9041:Fgd5	UTSW	6	91987446	missense	probably benign	0.15
R9173:Fgd5	UTSW	6	92067603	critical splice donor site	probably null
R9206:Fgd5	UTSW	6	92038210	missense	probably damaging	1.00
R9424:Fgd5	UTSW	6	91979036	nonsense	probably null
R9437:Fgd5	UTSW	6	91987646	missense	probably benign	0.07
R9715:Fgd5	UTSW	6	91988309	missense	possibly damaging	0.91
R9721:Fgd5	UTSW	6	91988297	missense	probably benign	0.09
X0064:Fgd5	UTSW	6	92050040	missense	probably benign	0.02
Z1176:Fgd5	UTSW	6	91988889	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGTTCATTCACCACTGAACATGTCTC -3'
(R):5'- CCTGCGTATCTAAGTGTCGTATGCC -3'

Sequencing Primer
(F):5'- TATCTTGGTCTCAAACACGAGGG -3'
(R):5'- TGCAGACAGTGTCAGACAAG -3'

Posted On

2014-04-24