Incidental Mutation 'R1606:Sash1'
ID176494
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene NameSAM and SH3 domain containing 1
Synonyms
MMRRC Submission 039643-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1606 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location8722219-8886070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8729957 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 890 (R890G)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449]
Predicted Effect probably benign
Transcript: ENSMUST00000015449
AA Change: R890G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: R890G

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,942,399 D1087N probably damaging Het
Abcc2 A G 19: 43,836,652 D1459G probably damaging Het
Adhfe1 G A 1: 9,553,473 probably null Het
Adsl C T 15: 80,952,224 Q61* probably null Het
Arhgap26 T A 18: 39,296,872 C214S probably damaging Het
Armc8 A T 9: 99,537,729 N9K probably damaging Het
Asxl1 A G 2: 153,400,455 D975G probably damaging Het
Atp8b3 T C 10: 80,532,578 E187G probably damaging Het
Cdcp2 T C 4: 107,102,513 S42P probably damaging Het
Chek1 A G 9: 36,719,524 L198P probably damaging Het
Dlc1 A G 8: 36,850,252 V423A probably benign Het
Dpy19l2 A G 9: 24,581,215 S696P probably benign Het
Echdc3 A T 2: 6,195,627 C183S possibly damaging Het
Exph5 A C 9: 53,374,295 D892A probably benign Het
Fam120b T A 17: 15,401,811 I17K possibly damaging Het
Fbln5 C T 12: 101,765,198 D246N probably benign Het
Fbxo15 A C 18: 84,962,620 K195T possibly damaging Het
Fzd1 C A 5: 4,757,514 E23* probably null Het
Gas2l1 C A 11: 5,064,434 A9S probably damaging Het
Gcc2 C T 10: 58,269,448 L69F probably damaging Het
Ggt6 C T 11: 72,437,733 A353V possibly damaging Het
Gm340 T G 19: 41,585,074 M756R probably benign Het
Gphn T A 12: 78,683,883 V764E probably damaging Het
Grid1 A T 14: 35,445,965 Y482F probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifit1bl1 C T 19: 34,594,044 V338M probably benign Het
Klhl14 T A 18: 21,565,532 Q408L possibly damaging Het
Lacc1 T A 14: 77,029,641 Q394L probably benign Het
Lipe A G 7: 25,388,144 F477L probably damaging Het
Lrig2 A G 3: 104,480,107 probably null Het
Megf8 T A 7: 25,358,695 H2131Q probably damaging Het
Nek1 A G 8: 61,124,276 D1097G possibly damaging Het
Nhlrc3 A T 3: 53,458,657 Y138* probably null Het
Nudcd2 T A 11: 40,736,007 probably null Het
Numb T C 12: 83,801,010 probably null Het
Olfr871 T G 9: 20,212,946 L199R probably benign Het
Pacrg G A 17: 10,839,838 Q11* probably null Het
Ppp1r37 A T 7: 19,534,999 M192K probably damaging Het
Prmt8 T A 6: 127,689,836 K392* probably null Het
Rab28 A T 5: 41,698,452 W67R probably damaging Het
Rad21l C T 2: 151,654,686 C365Y probably damaging Het
Rbm17 A T 2: 11,595,397 F147I probably benign Het
Rbm46 A C 3: 82,864,541 F256V probably damaging Het
Rcc1 A T 4: 132,334,776 probably null Het
Rnf217 G T 10: 31,534,811 T296N possibly damaging Het
Rnmt A G 18: 68,311,653 D231G possibly damaging Het
Rph3al C T 11: 75,906,541 V110I probably damaging Het
Rxfp2 T C 5: 150,059,897 M289T probably benign Het
Sf3b2 A T 19: 5,287,998 D245E probably benign Het
Skint9 A T 4: 112,389,201 V238E probably benign Het
Slc26a8 T A 17: 28,638,481 D896V possibly damaging Het
Slc35b4 T A 6: 34,158,388 K330* probably null Het
Slco1a4 G T 6: 141,839,611 H84Q probably damaging Het
Sptbn2 G T 19: 4,750,242 probably null Het
St6galnac3 A T 3: 153,206,668 D227E probably benign Het
Tek G A 4: 94,849,767 D685N probably damaging Het
Trf G T 9: 103,225,136 probably null Het
Trpm5 T A 7: 143,085,171 K288* probably null Het
Ttn C T 2: 76,737,012 V27846I probably damaging Het
Tyr A T 7: 87,437,971 D444E probably benign Het
Ucp1 C A 8: 83,295,304 A255E probably damaging Het
Ush2a A G 1: 188,759,766 D3084G probably benign Het
Yeats4 T C 10: 117,217,439 Y139C probably damaging Het
Zbtb6 A G 2: 37,429,118 V266A probably benign Het
Zfp784 A T 7: 5,035,775 N261K possibly damaging Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0647:Sash1 UTSW 10 8729552 missense probably damaging 0.99
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0830:Sash1 UTSW 10 8729909 missense probably benign 0.01
R0919:Sash1 UTSW 10 8730079 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1922:Sash1 UTSW 10 8727908 missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2252:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2260:Sash1 UTSW 10 8786378 nonsense probably null
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4039:Sash1 UTSW 10 8729627 missense probably damaging 1.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8751470 missense probably benign 0.00
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6679:Sash1 UTSW 10 8740185 missense probably damaging 1.00
R6761:Sash1 UTSW 10 8744522 missense probably damaging 0.99
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7289:Sash1 UTSW 10 8730196 missense probably damaging 0.99
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
R7752:Sash1 UTSW 10 8780564 nonsense probably null
R7856:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7901:Sash1 UTSW 10 8780564 nonsense probably null
R7939:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7984:Sash1 UTSW 10 8780564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTCAGTGAGATCAATGCCCTCC -3'
(R):5'- TTGGCAAGAATGTGCCTACCGAG -3'

Sequencing Primer
(F):5'- ACCAAGTGCAGGCCATTG -3'
(R):5'- GATGCCAGAAACCTGTTCTCAG -3'
Posted On2014-04-24