Incidental Mutation 'R1673:Zfp408'
ID187781
Institutional Source Beutler Lab
Gene Symbol Zfp408
Ensembl Gene ENSMUSG00000075040
Gene Namezinc finger protein 408
SynonymsLOC381410
MMRRC Submission 039709-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1673 (G1)
Quality Score222
Status Not validated
Chromosome2
Chromosomal Location91643669-91649791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91646008 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 367 (T367I)
Ref Sequence ENSEMBL: ENSMUSP00000097301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090614] [ENSMUST00000099714] [ENSMUST00000111329] [ENSMUST00000111331] [ENSMUST00000111333] [ENSMUST00000145582]
Predicted Effect probably benign
Transcript: ENSMUST00000090614
SMART Domains Protein: ENSMUSP00000088105
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099714
AA Change: T367I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097301
Gene: ENSMUSG00000075040
AA Change: T367I

DomainStartEndE-ValueType
ZnF_C2H2 344 366 7.05e-1 SMART
ZnF_C2H2 372 394 1.67e-2 SMART
ZnF_C2H2 400 422 2.24e-3 SMART
ZnF_C2H2 428 450 8.6e-5 SMART
ZnF_C2H2 459 481 5.9e-3 SMART
ZnF_C2H2 487 509 4.87e-4 SMART
ZnF_C2H2 515 537 2.95e-3 SMART
ZnF_C2H2 542 564 2.2e-2 SMART
ZnF_C2H2 570 592 1.69e-3 SMART
ZnF_C2H2 598 620 3.89e-3 SMART
low complexity region 625 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111329
SMART Domains Protein: ENSMUSP00000106961
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111331
SMART Domains Protein: ENSMUSP00000106963
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 44 58 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
SEC14 104 255 5.08e-25 SMART
low complexity region 264 278 N/A INTRINSIC
RhoGAP 297 468 1.06e-61 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111333
AA Change: T267I

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106965
Gene: ENSMUSG00000075040
AA Change: T267I

DomainStartEndE-ValueType
ZnF_C2H2 244 266 7.05e-1 SMART
ZnF_C2H2 272 294 1.67e-2 SMART
ZnF_C2H2 300 322 2.24e-3 SMART
ZnF_C2H2 328 350 8.6e-5 SMART
ZnF_C2H2 359 381 5.9e-3 SMART
ZnF_C2H2 387 409 4.87e-4 SMART
ZnF_C2H2 415 437 2.95e-3 SMART
ZnF_C2H2 442 464 2.2e-2 SMART
ZnF_C2H2 470 492 1.69e-3 SMART
ZnF_C2H2 498 520 3.89e-3 SMART
low complexity region 525 538 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127702
Predicted Effect probably benign
Transcript: ENSMUST00000145582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155045
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten tandem zinc fingers and an N-terminal SET domain, so it is likely a DNA binding protein that interacts with other proteins. In adults, the encoded protein is expressed most highly in retina. Consequently, defects in this gene have been associated with familial exudative vitreoretinopathy (FEVR) and retinitis pigmentosa (RP). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,339 S809G probably benign Het
Ap4b1 T A 3: 103,817,845 probably null Het
Aqp12 A G 1: 93,006,884 Q161R possibly damaging Het
Atp8a2 A G 14: 59,791,240 I926T probably benign Het
Cacna2d1 A T 5: 16,299,990 N314I probably damaging Het
Cd209d A G 8: 3,877,113 S81P probably damaging Het
Cdcp1 T A 9: 123,178,021 K554* probably null Het
Celsr1 A G 15: 85,932,457 Y1762H probably benign Het
Cklf A G 8: 104,257,351 T49A possibly damaging Het
Col12a1 T G 9: 79,693,538 I755L probably benign Het
Cts3 G A 13: 61,567,554 Q140* probably null Het
Ddx1 A T 12: 13,244,966 probably null Het
Dnah3 C A 7: 119,971,179 E2262* probably null Het
Dnah5 A G 15: 28,290,148 N1228S probably benign Het
Dsg1a G A 18: 20,331,504 R352Q probably damaging Het
Efcab5 A G 11: 77,151,853 F25L probably damaging Het
Efhd1 T A 1: 87,264,682 V78D probably damaging Het
Eif5a2 T C 3: 28,793,818 probably null Het
Elp2 T A 18: 24,611,926 V101D possibly damaging Het
Enpp2 A T 15: 54,910,196 probably null Het
F5 A G 1: 164,179,520 T298A probably damaging Het
Fam208b A G 13: 3,584,498 probably null Het
Fbxo21 G T 5: 118,008,064 R584L probably benign Het
Fbxw22 G T 9: 109,382,128 F368L possibly damaging Het
Gcn1l1 T C 5: 115,582,297 I409T probably benign Het
Gm10260 A T 13: 97,760,360 Y77N possibly damaging Het
Gm12887 T C 4: 121,616,458 Y65C probably damaging Het
Gria4 G A 9: 4,537,637 Q224* probably null Het
Hdac5 C T 11: 102,198,805 V860M probably damaging Het
Ino80 G A 2: 119,381,936 R1302C probably damaging Het
Kcns2 A T 15: 34,838,820 I110F probably damaging Het
Lrig3 A G 10: 126,010,167 T822A probably damaging Het
Mapk6 T C 9: 75,395,569 D214G probably damaging Het
Mcm2 A T 6: 88,892,078 L264Q probably benign Het
Mpnd A T 17: 56,010,455 Y64F probably damaging Het
Muc1 T A 3: 89,231,772 M520K possibly damaging Het
Muc4 T A 16: 32,756,902 S189T probably benign Het
Myh13 T C 11: 67,352,119 S953P possibly damaging Het
Ncf2 A T 1: 152,830,479 M281L probably benign Het
Nipal2 A G 15: 34,648,695 I116T probably damaging Het
Nptn T C 9: 58,623,732 L46P probably benign Het
Olfr11 A T 13: 21,639,044 S160T probably damaging Het
Olfr1283 A G 2: 111,369,207 T192A probably benign Het
Olfr290 T A 7: 84,916,117 F113I probably damaging Het
Olfr610 C A 7: 103,506,689 V86F probably damaging Het
Pgr A T 9: 8,902,068 Y534F possibly damaging Het
Pip4k2a A T 2: 18,872,282 probably null Het
Pkd1l2 C G 8: 117,040,775 V1259L probably benign Het
Ppp1r12a A G 10: 108,249,565 E457G probably damaging Het
Rasa4 T A 5: 136,104,637 V650D probably benign Het
Rem2 C T 14: 54,476,309 probably benign Het
Sdc1 G A 12: 8,790,409 R62Q possibly damaging Het
Sdk1 A G 5: 141,948,506 E366G possibly damaging Het
Setd2 T A 9: 110,604,180 H2406Q probably damaging Het
Slc30a5 A G 13: 100,813,383 V397A probably benign Het
Slc36a2 A T 11: 55,184,913 L16H possibly damaging Het
Slc44a1 T C 4: 53,542,468 V334A probably benign Het
Sox8 A T 17: 25,567,482 Y416N possibly damaging Het
Speg T C 1: 75,411,163 V1416A possibly damaging Het
Stk24 T A 14: 121,337,571 I42F probably damaging Het
Tcerg1 T A 18: 42,552,581 L661Q possibly damaging Het
Tmem110 T C 14: 30,864,434 L72S possibly damaging Het
Tpp1 G A 7: 105,747,673 R417W probably damaging Het
Trim12a T A 7: 104,306,057 D153V possibly damaging Het
Trpm2 T C 10: 77,942,944 N396S probably benign Het
Ttn T C 2: 76,807,083 K5695R probably damaging Het
Ttn G A 2: 76,810,287 R11960C probably damaging Het
Tulp3 A C 6: 128,333,943 probably null Het
Uaca T A 9: 60,872,156 L1273H probably damaging Het
Usp33 A G 3: 152,368,282 E255G probably damaging Het
Vmn2r54 T G 7: 12,616,211 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wnt5b A T 6: 119,446,354 F116L probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Zbtb12 TCATC TCATCCATC 17: 34,896,310 probably null Het
Zfp512b G A 2: 181,588,493 A480V possibly damaging Het
Zfp560 T C 9: 20,347,653 T638A probably benign Het
Zfp932 G T 5: 110,008,988 G151V probably damaging Het
Zpbp T C 11: 11,352,696 K320E probably damaging Het
Zranb2 C T 3: 157,537,640 P91L probably damaging Het
Other mutations in Zfp408
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Zfp408 APN 2 91648006 splice site probably benign
IGL02374:Zfp408 APN 2 91645811 missense probably damaging 1.00
IGL03012:Zfp408 APN 2 91647808 missense probably benign
Innuendo UTSW 2 91646345 missense probably benign 0.06
Slander UTSW 2 91647849 splice site probably benign
R0467:Zfp408 UTSW 2 91645537 missense possibly damaging 0.86
R0981:Zfp408 UTSW 2 91645183 missense probably benign 0.38
R1579:Zfp408 UTSW 2 91646128 missense probably benign 0.05
R1935:Zfp408 UTSW 2 91649748 start codon destroyed probably null 0.95
R2071:Zfp408 UTSW 2 91646018 missense probably damaging 0.96
R2127:Zfp408 UTSW 2 91645174 missense probably damaging 0.98
R2141:Zfp408 UTSW 2 91647849 splice site probably benign
R3688:Zfp408 UTSW 2 91646432 missense probably benign 0.00
R4681:Zfp408 UTSW 2 91645786 missense probably damaging 1.00
R4782:Zfp408 UTSW 2 91645024 missense possibly damaging 0.88
R4939:Zfp408 UTSW 2 91645105 missense probably damaging 1.00
R5306:Zfp408 UTSW 2 91646345 missense probably benign 0.06
R5344:Zfp408 UTSW 2 91645243 missense probably benign 0.15
R6054:Zfp408 UTSW 2 91649291 missense probably benign 0.00
R7985:Zfp408 UTSW 2 91646431 missense probably benign
R8193:Zfp408 UTSW 2 91645016 missense probably benign 0.00
Z1176:Zfp408 UTSW 2 91647805 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTTTTGCCGCATTGCTCACAC -3'
(R):5'- GTTGCTTCACGATGACAGCATGG -3'

Sequencing Primer
(F):5'- GCATTGCTCACACACAAAGGG -3'
(R):5'- TTAGATGTCCCCAGCAGTCAG -3'
Posted On2014-05-09