Mutagenetix > Incidental Mutations

Incidental Mutation 'R1673:Sox8'

187861

Institutional Source

Beutler Lab

Gene Symbol

Sox8

Ensembl Gene

ENSMUSG00000024176

Gene Name

SRY (sex determining region Y)-box 8

Synonyms

MMRRC Submission

039709-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1673 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25565892-25570686 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25567482 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 416 (Y416N)

Ref Sequence

ENSEMBL: ENSMUSP00000025003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025003] [ENSMUST00000173447]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025003
AA Change: Y416N

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000025003
Gene: ENSMUSG00000024176
AA Change: Y416N

Domain	Start	End	E-Value	Type
Pfam:Sox_N	18	86	3.8e-27	PFAM
HMG	98	168	3.86e-28	SMART
low complexity region	208	228	N/A	INTRINSIC
low complexity region	303	321	N/A	INTRINSIC
low complexity region	375	397	N/A	INTRINSIC
low complexity region	407	425	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163493

Predicted Effect

probably benign
Transcript: ENSMUST00000173447

SMART Domains

Protein: ENSMUSP00000133403
Gene: ENSMUSG00000024176

Domain	Start	End	E-Value	Type
Pfam:Sox_N	3	87	3.3e-25	PFAM
HMG	98	168	3.86e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174560

SMART Domains

Protein: ENSMUSP00000133742
Gene: ENSMUSG00000024176

Domain	Start	End	E-Value	Type
HMG	1	66	1.19e-19	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein may be involved in brain development and function. Haploinsufficiency for this protein may contribute to the mental retardation found in haemoglobin H-related mental retardation (ART-16 syndrome). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a 30% decrease in adult body weight due to diminished fat stores, and a reduction of several tarsals which subsequently fail to fuse. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,212,339	S809G	probably benign	Het
Ap4b1	T	A	3: 103,817,845		probably null	Het
Aqp12	A	G	1: 93,006,884	Q161R	possibly damaging	Het
Atp8a2	A	G	14: 59,791,240	I926T	probably benign	Het
Cacna2d1	A	T	5: 16,299,990	N314I	probably damaging	Het
Cd209d	A	G	8: 3,877,113	S81P	probably damaging	Het
Cdcp1	T	A	9: 123,178,021	K554*	probably null	Het
Celsr1	A	G	15: 85,932,457	Y1762H	probably benign	Het
Cklf	A	G	8: 104,257,351	T49A	possibly damaging	Het
Col12a1	T	G	9: 79,693,538	I755L	probably benign	Het
Cts3	G	A	13: 61,567,554	Q140*	probably null	Het
Ddx1	A	T	12: 13,244,966		probably null	Het
Dnah3	C	A	7: 119,971,179	E2262*	probably null	Het
Dnah5	A	G	15: 28,290,148	N1228S	probably benign	Het
Dsg1a	G	A	18: 20,331,504	R352Q	probably damaging	Het
Efcab5	A	G	11: 77,151,853	F25L	probably damaging	Het
Efhd1	T	A	1: 87,264,682	V78D	probably damaging	Het
Eif5a2	T	C	3: 28,793,818		probably null	Het
Elp2	T	A	18: 24,611,926	V101D	possibly damaging	Het
Enpp2	A	T	15: 54,910,196		probably null	Het
F5	A	G	1: 164,179,520	T298A	probably damaging	Het
Fam208b	A	G	13: 3,584,498		probably null	Het
Fbxo21	G	T	5: 118,008,064	R584L	probably benign	Het
Fbxw22	G	T	9: 109,382,128	F368L	possibly damaging	Het
Gcn1l1	T	C	5: 115,582,297	I409T	probably benign	Het
Gm10260	A	T	13: 97,760,360	Y77N	possibly damaging	Het
Gm12887	T	C	4: 121,616,458	Y65C	probably damaging	Het
Gria4	G	A	9: 4,537,637	Q224*	probably null	Het
Hdac5	C	T	11: 102,198,805	V860M	probably damaging	Het
Ino80	G	A	2: 119,381,936	R1302C	probably damaging	Het
Kcns2	A	T	15: 34,838,820	I110F	probably damaging	Het
Lrig3	A	G	10: 126,010,167	T822A	probably damaging	Het
Mapk6	T	C	9: 75,395,569	D214G	probably damaging	Het
Mcm2	A	T	6: 88,892,078	L264Q	probably benign	Het
Mpnd	A	T	17: 56,010,455	Y64F	probably damaging	Het
Muc1	T	A	3: 89,231,772	M520K	possibly damaging	Het
Muc4	T	A	16: 32,756,902	S189T	probably benign	Het
Myh13	T	C	11: 67,352,119	S953P	possibly damaging	Het
Ncf2	A	T	1: 152,830,479	M281L	probably benign	Het
Nipal2	A	G	15: 34,648,695	I116T	probably damaging	Het
Nptn	T	C	9: 58,623,732	L46P	probably benign	Het
Olfr11	A	T	13: 21,639,044	S160T	probably damaging	Het
Olfr1283	A	G	2: 111,369,207	T192A	probably benign	Het
Olfr290	T	A	7: 84,916,117	F113I	probably damaging	Het
Olfr610	C	A	7: 103,506,689	V86F	probably damaging	Het
Pgr	A	T	9: 8,902,068	Y534F	possibly damaging	Het
Pip4k2a	A	T	2: 18,872,282		probably null	Het
Pkd1l2	C	G	8: 117,040,775	V1259L	probably benign	Het
Ppp1r12a	A	G	10: 108,249,565	E457G	probably damaging	Het
Rasa4	T	A	5: 136,104,637	V650D	probably benign	Het
Rem2	C	T	14: 54,476,309		probably benign	Het
Sdc1	G	A	12: 8,790,409	R62Q	possibly damaging	Het
Sdk1	A	G	5: 141,948,506	E366G	possibly damaging	Het
Setd2	T	A	9: 110,604,180	H2406Q	probably damaging	Het
Slc30a5	A	G	13: 100,813,383	V397A	probably benign	Het
Slc36a2	A	T	11: 55,184,913	L16H	possibly damaging	Het
Slc44a1	T	C	4: 53,542,468	V334A	probably benign	Het
Speg	T	C	1: 75,411,163	V1416A	possibly damaging	Het
Stk24	T	A	14: 121,337,571	I42F	probably damaging	Het
Tcerg1	T	A	18: 42,552,581	L661Q	possibly damaging	Het
Tmem110	T	C	14: 30,864,434	L72S	possibly damaging	Het
Tpp1	G	A	7: 105,747,673	R417W	probably damaging	Het
Trim12a	T	A	7: 104,306,057	D153V	possibly damaging	Het
Trpm2	T	C	10: 77,942,944	N396S	probably benign	Het
Ttn	T	C	2: 76,807,083	K5695R	probably damaging	Het
Ttn	G	A	2: 76,810,287	R11960C	probably damaging	Het
Tulp3	A	C	6: 128,333,943		probably null	Het
Uaca	T	A	9: 60,872,156	L1273H	probably damaging	Het
Usp33	A	G	3: 152,368,282	E255G	probably damaging	Het
Vmn2r54	T	G	7: 12,616,211		probably null	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wnt5b	A	T	6: 119,446,354	F116L	probably benign	Het
Zbtb12	CTTCAT	CTTCATTCAT	17: 34,896,308		probably null	Het
Zbtb12	TCATC	TCATCCATC	17: 34,896,310		probably null	Het
Zfp408	G	A	2: 91,646,008	T367I	probably damaging	Het
Zfp512b	G	A	2: 181,588,493	A480V	possibly damaging	Het
Zfp560	T	C	9: 20,347,653	T638A	probably benign	Het
Zfp932	G	T	5: 110,008,988	G151V	probably damaging	Het
Zpbp	T	C	11: 11,352,696	K320E	probably damaging	Het
Zranb2	C	T	3: 157,537,640	P91L	probably damaging	Het

Other mutations in Sox8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01417:Sox8	APN	17	25567528	splice site	probably null
IGL01918:Sox8	APN	17	25570137	missense	probably damaging	1.00
IGL02672:Sox8	APN	17	25568989	missense	probably damaging	1.00
IGL03371:Sox8	APN	17	25567440	missense	probably damaging	1.00
R1398:Sox8	UTSW	17	25567883	missense	probably benign	0.01
R1742:Sox8	UTSW	17	25567941	missense	probably damaging	0.99
R4019:Sox8	UTSW	17	25570297	missense	probably damaging	1.00
R4353:Sox8	UTSW	17	25567335	makesense	probably null
R4466:Sox8	UTSW	17	25568905	missense	probably benign	0.37
R4893:Sox8	UTSW	17	25568989	missense	probably damaging	1.00
R4929:Sox8	UTSW	17	25570356	missense	probably benign	0.21
R5915:Sox8	UTSW	17	25567469	missense	probably damaging	1.00
R6114:Sox8	UTSW	17	25567520	missense	probably damaging	1.00
R6915:Sox8	UTSW	17	25567914	missense	probably damaging	1.00
R7030:Sox8	UTSW	17	25570108	critical splice donor site	probably null
R7232:Sox8	UTSW	17	25567540	missense	probably benign	0.01
R7549:Sox8	UTSW	17	25567961	missense	probably damaging	0.99
R8262:Sox8	UTSW	17	25567643	missense	possibly damaging	0.89
Z1177:Sox8	UTSW	17	25567743	missense	probably benign	0.00
Z1177:Sox8	UTSW	17	25568984	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGACAAAGCCTGGCTTCCTGCAC -3'
(R):5'- AGCTGAGTCCTAGCCACTACAACG -3'

Sequencing Primer
(F):5'- ATTCAGCAGGCACTTGACG -3'
(R):5'- CGACCAGTCACATGGCTC -3'

Posted On

2014-05-09