Incidental Mutation 'R1673:Tpp1'
ID187808
Institutional Source Beutler Lab
Gene Symbol Tpp1
Ensembl Gene ENSMUSG00000030894
Gene Nametripeptidyl peptidase I
SynonymsCln2
MMRRC Submission 039709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1673 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105744811-105752235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105747673 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 417 (R417W)
Ref Sequence ENSEMBL: ENSMUSP00000033184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033182] [ENSMUST00000033184] [ENSMUST00000141116] [ENSMUST00000149695] [ENSMUST00000163389] [ENSMUST00000210066]
Predicted Effect probably benign
Transcript: ENSMUST00000033182
SMART Domains Protein: ENSMUSP00000033182
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase 193 445 1.5e-25 PFAM
Pfam:Pkinase_Tyr 193 446 7.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000033184
AA Change: R417W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894
AA Change: R417W

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054556
Predicted Effect probably benign
Transcript: ENSMUST00000130565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131683
Predicted Effect probably benign
Transcript: ENSMUST00000141116
SMART Domains Protein: ENSMUSP00000118105
Gene: ENSMUSG00000043866

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 45 91 N/A INTRINSIC
Pfam:TFIID_30kDa 128 177 6.1e-30 PFAM
low complexity region 181 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146999
Predicted Effect probably benign
Transcript: ENSMUST00000149695
Predicted Effect probably benign
Transcript: ENSMUST00000163389
SMART Domains Protein: ENSMUSP00000130341
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase_Tyr 193 446 4e-39 PFAM
Pfam:Pkinase 195 445 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210018
Predicted Effect probably benign
Transcript: ENSMUST00000210066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211659
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysosomal serine protease that cleaves N-terminal tripeptides from protein substrates. The encoded preproprotein undergoes autocatalytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit a progressive neurodegeneration and a greatly shortened lifespan. At the cellular level, mice lacking the encoded protein exhibit accumulation of autofluorescent lipopigments. Mutations in the human ortholog of this gene cause classical late-infantile neuronal ceroid lipofuscinosis. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted mutations exhibit progressive motor defects, reduced lifespan, and respiratory difficulty. One mutation also shows extensive neuronal degeneration and an accumulation of lysosomal storage material. Mice homozygous for a different allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,339 S809G probably benign Het
Ap4b1 T A 3: 103,817,845 probably null Het
Aqp12 A G 1: 93,006,884 Q161R possibly damaging Het
Atp8a2 A G 14: 59,791,240 I926T probably benign Het
Cacna2d1 A T 5: 16,299,990 N314I probably damaging Het
Cd209d A G 8: 3,877,113 S81P probably damaging Het
Cdcp1 T A 9: 123,178,021 K554* probably null Het
Celsr1 A G 15: 85,932,457 Y1762H probably benign Het
Cklf A G 8: 104,257,351 T49A possibly damaging Het
Col12a1 T G 9: 79,693,538 I755L probably benign Het
Cts3 G A 13: 61,567,554 Q140* probably null Het
Ddx1 A T 12: 13,244,966 probably null Het
Dnah3 C A 7: 119,971,179 E2262* probably null Het
Dnah5 A G 15: 28,290,148 N1228S probably benign Het
Dsg1a G A 18: 20,331,504 R352Q probably damaging Het
Efcab5 A G 11: 77,151,853 F25L probably damaging Het
Efhd1 T A 1: 87,264,682 V78D probably damaging Het
Eif5a2 T C 3: 28,793,818 probably null Het
Elp2 T A 18: 24,611,926 V101D possibly damaging Het
Enpp2 A T 15: 54,910,196 probably null Het
F5 A G 1: 164,179,520 T298A probably damaging Het
Fam208b A G 13: 3,584,498 probably null Het
Fbxo21 G T 5: 118,008,064 R584L probably benign Het
Fbxw22 G T 9: 109,382,128 F368L possibly damaging Het
Gcn1l1 T C 5: 115,582,297 I409T probably benign Het
Gm10260 A T 13: 97,760,360 Y77N possibly damaging Het
Gm12887 T C 4: 121,616,458 Y65C probably damaging Het
Gria4 G A 9: 4,537,637 Q224* probably null Het
Hdac5 C T 11: 102,198,805 V860M probably damaging Het
Ino80 G A 2: 119,381,936 R1302C probably damaging Het
Kcns2 A T 15: 34,838,820 I110F probably damaging Het
Lrig3 A G 10: 126,010,167 T822A probably damaging Het
Mapk6 T C 9: 75,395,569 D214G probably damaging Het
Mcm2 A T 6: 88,892,078 L264Q probably benign Het
Mpnd A T 17: 56,010,455 Y64F probably damaging Het
Muc1 T A 3: 89,231,772 M520K possibly damaging Het
Muc4 T A 16: 32,756,902 S189T probably benign Het
Myh13 T C 11: 67,352,119 S953P possibly damaging Het
Ncf2 A T 1: 152,830,479 M281L probably benign Het
Nipal2 A G 15: 34,648,695 I116T probably damaging Het
Nptn T C 9: 58,623,732 L46P probably benign Het
Olfr11 A T 13: 21,639,044 S160T probably damaging Het
Olfr1283 A G 2: 111,369,207 T192A probably benign Het
Olfr290 T A 7: 84,916,117 F113I probably damaging Het
Olfr610 C A 7: 103,506,689 V86F probably damaging Het
Pgr A T 9: 8,902,068 Y534F possibly damaging Het
Pip4k2a A T 2: 18,872,282 probably null Het
Pkd1l2 C G 8: 117,040,775 V1259L probably benign Het
Ppp1r12a A G 10: 108,249,565 E457G probably damaging Het
Rasa4 T A 5: 136,104,637 V650D probably benign Het
Rem2 C T 14: 54,476,309 probably benign Het
Sdc1 G A 12: 8,790,409 R62Q possibly damaging Het
Sdk1 A G 5: 141,948,506 E366G possibly damaging Het
Setd2 T A 9: 110,604,180 H2406Q probably damaging Het
Slc30a5 A G 13: 100,813,383 V397A probably benign Het
Slc36a2 A T 11: 55,184,913 L16H possibly damaging Het
Slc44a1 T C 4: 53,542,468 V334A probably benign Het
Sox8 A T 17: 25,567,482 Y416N possibly damaging Het
Speg T C 1: 75,411,163 V1416A possibly damaging Het
Stk24 T A 14: 121,337,571 I42F probably damaging Het
Tcerg1 T A 18: 42,552,581 L661Q possibly damaging Het
Tmem110 T C 14: 30,864,434 L72S possibly damaging Het
Trim12a T A 7: 104,306,057 D153V possibly damaging Het
Trpm2 T C 10: 77,942,944 N396S probably benign Het
Ttn T C 2: 76,807,083 K5695R probably damaging Het
Ttn G A 2: 76,810,287 R11960C probably damaging Het
Tulp3 A C 6: 128,333,943 probably null Het
Uaca T A 9: 60,872,156 L1273H probably damaging Het
Usp33 A G 3: 152,368,282 E255G probably damaging Het
Vmn2r54 T G 7: 12,616,211 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wnt5b A T 6: 119,446,354 F116L probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Zbtb12 TCATC TCATCCATC 17: 34,896,310 probably null Het
Zfp408 G A 2: 91,646,008 T367I probably damaging Het
Zfp512b G A 2: 181,588,493 A480V possibly damaging Het
Zfp560 T C 9: 20,347,653 T638A probably benign Het
Zfp932 G T 5: 110,008,988 G151V probably damaging Het
Zpbp T C 11: 11,352,696 K320E probably damaging Het
Zranb2 C T 3: 157,537,640 P91L probably damaging Het
Other mutations in Tpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Tpp1 APN 7 105749053 missense probably damaging 1.00
IGL01520:Tpp1 APN 7 105747729 missense probably benign 0.32
IGL01796:Tpp1 APN 7 105747650 unclassified probably benign
IGL01797:Tpp1 APN 7 105749252 missense probably benign 0.07
IGL01923:Tpp1 APN 7 105751650 missense probably benign 0.34
IGL02400:Tpp1 APN 7 105747031 missense possibly damaging 0.91
IGL02411:Tpp1 APN 7 105749619 missense probably damaging 1.00
IGL02423:Tpp1 APN 7 105749700 missense probably damaging 1.00
IGL02672:Tpp1 APN 7 105746961 missense probably benign
IGL03180:Tpp1 APN 7 105746649 missense probably benign
R0709:Tpp1 UTSW 7 105749607 missense probably benign 0.19
R0711:Tpp1 UTSW 7 105749419 missense probably damaging 1.00
R1222:Tpp1 UTSW 7 105746741 missense probably benign 0.05
R1799:Tpp1 UTSW 7 105750308 missense probably benign 0.00
R1822:Tpp1 UTSW 7 105749647 missense probably benign
R1984:Tpp1 UTSW 7 105751698 missense probably benign 0.04
R2109:Tpp1 UTSW 7 105749970 missense probably damaging 1.00
R4304:Tpp1 UTSW 7 105750309 missense possibly damaging 0.70
R4618:Tpp1 UTSW 7 105751706 missense probably benign 0.05
R4746:Tpp1 UTSW 7 105748951 missense probably damaging 1.00
R4764:Tpp1 UTSW 7 105749251 missense probably damaging 1.00
R4837:Tpp1 UTSW 7 105746649 missense probably benign
R4855:Tpp1 UTSW 7 105746723 missense probably benign
R5015:Tpp1 UTSW 7 105752025 unclassified probably benign
R5677:Tpp1 UTSW 7 105747536 missense probably damaging 1.00
R5916:Tpp1 UTSW 7 105749380 missense probably damaging 0.97
R6149:Tpp1 UTSW 7 105747727 missense probably benign 0.00
R6291:Tpp1 UTSW 7 105747016 missense probably benign 0.05
R6422:Tpp1 UTSW 7 105746956 missense probably benign 0.01
R6671:Tpp1 UTSW 7 105749607 missense probably benign 0.19
R6841:Tpp1 UTSW 7 105748964 missense probably damaging 0.96
R6851:Tpp1 UTSW 7 105749712 missense probably damaging 1.00
R7022:Tpp1 UTSW 7 105748922 missense probably damaging 1.00
R7106:Tpp1 UTSW 7 105749911 missense possibly damaging 0.67
R7260:Tpp1 UTSW 7 105747497 missense probably benign 0.00
R7485:Tpp1 UTSW 7 105749544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTTCAAGAACTGGGCCACTGC -3'
(R):5'- TCCCTTTTCCAGTAAGACCCAGACC -3'

Sequencing Primer
(F):5'- ACTGCTTCCTCCTGAAGGAC -3'
(R):5'- acccacgaccatcagcc -3'
Posted On2014-05-09