Mutagenetix > Incidental Mutations

Incidental Mutation 'R1673:Tpp1'

187808

Institutional Source

Beutler Lab

Gene Symbol

Tpp1

Ensembl Gene

ENSMUSG00000030894

Gene Name

tripeptidyl peptidase I

Synonyms

Cln2

MMRRC Submission

039709-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1673 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105744811-105752235 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 105747673 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 417 (R417W)

Ref Sequence

ENSEMBL: ENSMUSP00000033184 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033182] [ENSMUST00000033184] [ENSMUST00000141116] [ENSMUST00000149695] [ENSMUST00000163389] [ENSMUST00000210066]

Predicted Effect

probably benign
Transcript: ENSMUST00000033182

SMART Domains

Protein: ENSMUSP00000033182
Gene: ENSMUSG00000030890

Domain	Start	End	E-Value	Type
ANK	33	62	4.71e-6	SMART
ANK	66	95	1.04e-7	SMART
ANK	99	128	1.02e-1	SMART
Pfam:Pkinase	193	445	1.5e-25	PFAM
Pfam:Pkinase_Tyr	193	446	7.2e-40	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000033184
AA Change: R417W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894
AA Change: R417W

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
Pro-kuma_activ	32	176	4.53e-50	SMART
low complexity region	177	189	N/A	INTRINSIC
Pfam:Peptidase_S8	251	492	1.1e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000054556

Predicted Effect

probably benign
Transcript: ENSMUST00000130565

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131683

Predicted Effect

probably benign
Transcript: ENSMUST00000141116

SMART Domains

Protein: ENSMUSP00000118105
Gene: ENSMUSG00000043866

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	45	91	N/A	INTRINSIC
Pfam:TFIID_30kDa	128	177	6.1e-30	PFAM
low complexity region	181	192	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146999

Predicted Effect

probably benign
Transcript: ENSMUST00000149695

Predicted Effect

probably benign
Transcript: ENSMUST00000163389

SMART Domains

Protein: ENSMUSP00000130341
Gene: ENSMUSG00000030890

Domain	Start	End	E-Value	Type
ANK	33	62	4.71e-6	SMART
ANK	66	95	1.04e-7	SMART
ANK	99	128	1.02e-1	SMART
Pfam:Pkinase_Tyr	193	446	4e-39	PFAM
Pfam:Pkinase	195	445	3e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210018

Predicted Effect

probably benign
Transcript: ENSMUST00000210066

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210395

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210730

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210840

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211204

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211226

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211560

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211659

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a lysosomal serine protease that cleaves N-terminal tripeptides from protein substrates. The encoded preproprotein undergoes autocatalytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit a progressive neurodegeneration and a greatly shortened lifespan. At the cellular level, mice lacking the encoded protein exhibit accumulation of autofluorescent lipopigments. Mutations in the human ortholog of this gene cause classical late-infantile neuronal ceroid lipofuscinosis. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted mutations exhibit progressive motor defects, reduced lifespan, and respiratory difficulty. One mutation also shows extensive neuronal degeneration and an accumulation of lysosomal storage material. Mice homozygous for a different allele exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,212,339	S809G	probably benign	Het
Ap4b1	T	A	3: 103,817,845		probably null	Het
Aqp12	A	G	1: 93,006,884	Q161R	possibly damaging	Het
Atp8a2	A	G	14: 59,791,240	I926T	probably benign	Het
Cacna2d1	A	T	5: 16,299,990	N314I	probably damaging	Het
Cd209d	A	G	8: 3,877,113	S81P	probably damaging	Het
Cdcp1	T	A	9: 123,178,021	K554*	probably null	Het
Celsr1	A	G	15: 85,932,457	Y1762H	probably benign	Het
Cklf	A	G	8: 104,257,351	T49A	possibly damaging	Het
Col12a1	T	G	9: 79,693,538	I755L	probably benign	Het
Cts3	G	A	13: 61,567,554	Q140*	probably null	Het
Ddx1	A	T	12: 13,244,966		probably null	Het
Dnah3	C	A	7: 119,971,179	E2262*	probably null	Het
Dnah5	A	G	15: 28,290,148	N1228S	probably benign	Het
Dsg1a	G	A	18: 20,331,504	R352Q	probably damaging	Het
Efcab5	A	G	11: 77,151,853	F25L	probably damaging	Het
Efhd1	T	A	1: 87,264,682	V78D	probably damaging	Het
Eif5a2	T	C	3: 28,793,818		probably null	Het
Elp2	T	A	18: 24,611,926	V101D	possibly damaging	Het
Enpp2	A	T	15: 54,910,196		probably null	Het
F5	A	G	1: 164,179,520	T298A	probably damaging	Het
Fam208b	A	G	13: 3,584,498		probably null	Het
Fbxo21	G	T	5: 118,008,064	R584L	probably benign	Het
Fbxw22	G	T	9: 109,382,128	F368L	possibly damaging	Het
Gcn1l1	T	C	5: 115,582,297	I409T	probably benign	Het
Gm10260	A	T	13: 97,760,360	Y77N	possibly damaging	Het
Gm12887	T	C	4: 121,616,458	Y65C	probably damaging	Het
Gria4	G	A	9: 4,537,637	Q224*	probably null	Het
Hdac5	C	T	11: 102,198,805	V860M	probably damaging	Het
Ino80	G	A	2: 119,381,936	R1302C	probably damaging	Het
Kcns2	A	T	15: 34,838,820	I110F	probably damaging	Het
Lrig3	A	G	10: 126,010,167	T822A	probably damaging	Het
Mapk6	T	C	9: 75,395,569	D214G	probably damaging	Het
Mcm2	A	T	6: 88,892,078	L264Q	probably benign	Het
Mpnd	A	T	17: 56,010,455	Y64F	probably damaging	Het
Muc1	T	A	3: 89,231,772	M520K	possibly damaging	Het
Muc4	T	A	16: 32,756,902	S189T	probably benign	Het
Myh13	T	C	11: 67,352,119	S953P	possibly damaging	Het
Ncf2	A	T	1: 152,830,479	M281L	probably benign	Het
Nipal2	A	G	15: 34,648,695	I116T	probably damaging	Het
Nptn	T	C	9: 58,623,732	L46P	probably benign	Het
Olfr11	A	T	13: 21,639,044	S160T	probably damaging	Het
Olfr1283	A	G	2: 111,369,207	T192A	probably benign	Het
Olfr290	T	A	7: 84,916,117	F113I	probably damaging	Het
Olfr610	C	A	7: 103,506,689	V86F	probably damaging	Het
Pgr	A	T	9: 8,902,068	Y534F	possibly damaging	Het
Pip4k2a	A	T	2: 18,872,282		probably null	Het
Pkd1l2	C	G	8: 117,040,775	V1259L	probably benign	Het
Ppp1r12a	A	G	10: 108,249,565	E457G	probably damaging	Het
Rasa4	T	A	5: 136,104,637	V650D	probably benign	Het
Rem2	C	T	14: 54,476,309		probably benign	Het
Sdc1	G	A	12: 8,790,409	R62Q	possibly damaging	Het
Sdk1	A	G	5: 141,948,506	E366G	possibly damaging	Het
Setd2	T	A	9: 110,604,180	H2406Q	probably damaging	Het
Slc30a5	A	G	13: 100,813,383	V397A	probably benign	Het
Slc36a2	A	T	11: 55,184,913	L16H	possibly damaging	Het
Slc44a1	T	C	4: 53,542,468	V334A	probably benign	Het
Sox8	A	T	17: 25,567,482	Y416N	possibly damaging	Het
Speg	T	C	1: 75,411,163	V1416A	possibly damaging	Het
Stk24	T	A	14: 121,337,571	I42F	probably damaging	Het
Tcerg1	T	A	18: 42,552,581	L661Q	possibly damaging	Het
Tmem110	T	C	14: 30,864,434	L72S	possibly damaging	Het
Trim12a	T	A	7: 104,306,057	D153V	possibly damaging	Het
Trpm2	T	C	10: 77,942,944	N396S	probably benign	Het
Ttn	T	C	2: 76,807,083	K5695R	probably damaging	Het
Ttn	G	A	2: 76,810,287	R11960C	probably damaging	Het
Tulp3	A	C	6: 128,333,943		probably null	Het
Uaca	T	A	9: 60,872,156	L1273H	probably damaging	Het
Usp33	A	G	3: 152,368,282	E255G	probably damaging	Het
Vmn2r54	T	G	7: 12,616,211		probably null	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wnt5b	A	T	6: 119,446,354	F116L	probably benign	Het
Zbtb12	CTTCAT	CTTCATTCAT	17: 34,896,308		probably null	Het
Zbtb12	TCATC	TCATCCATC	17: 34,896,310		probably null	Het
Zfp408	G	A	2: 91,646,008	T367I	probably damaging	Het
Zfp512b	G	A	2: 181,588,493	A480V	possibly damaging	Het
Zfp560	T	C	9: 20,347,653	T638A	probably benign	Het
Zfp932	G	T	5: 110,008,988	G151V	probably damaging	Het
Zpbp	T	C	11: 11,352,696	K320E	probably damaging	Het
Zranb2	C	T	3: 157,537,640	P91L	probably damaging	Het

Other mutations in Tpp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01480:Tpp1	APN	7	105749053	missense	probably damaging	1.00
IGL01520:Tpp1	APN	7	105747729	missense	probably benign	0.32
IGL01796:Tpp1	APN	7	105747650	unclassified	probably benign
IGL01797:Tpp1	APN	7	105749252	missense	probably benign	0.07
IGL01923:Tpp1	APN	7	105751650	missense	probably benign	0.34
IGL02400:Tpp1	APN	7	105747031	missense	possibly damaging	0.91
IGL02411:Tpp1	APN	7	105749619	missense	probably damaging	1.00
IGL02423:Tpp1	APN	7	105749700	missense	probably damaging	1.00
IGL02672:Tpp1	APN	7	105746961	missense	probably benign
IGL03180:Tpp1	APN	7	105746649	missense	probably benign
R0709:Tpp1	UTSW	7	105749607	missense	probably benign	0.19
R0711:Tpp1	UTSW	7	105749419	missense	probably damaging	1.00
R1222:Tpp1	UTSW	7	105746741	missense	probably benign	0.05
R1799:Tpp1	UTSW	7	105750308	missense	probably benign	0.00
R1822:Tpp1	UTSW	7	105749647	missense	probably benign
R1984:Tpp1	UTSW	7	105751698	missense	probably benign	0.04
R2109:Tpp1	UTSW	7	105749970	missense	probably damaging	1.00
R4304:Tpp1	UTSW	7	105750309	missense	possibly damaging	0.70
R4618:Tpp1	UTSW	7	105751706	missense	probably benign	0.05
R4746:Tpp1	UTSW	7	105748951	missense	probably damaging	1.00
R4764:Tpp1	UTSW	7	105749251	missense	probably damaging	1.00
R4837:Tpp1	UTSW	7	105746649	missense	probably benign
R4855:Tpp1	UTSW	7	105746723	missense	probably benign
R5015:Tpp1	UTSW	7	105752025	unclassified	probably benign
R5677:Tpp1	UTSW	7	105747536	missense	probably damaging	1.00
R5916:Tpp1	UTSW	7	105749380	missense	probably damaging	0.97
R6149:Tpp1	UTSW	7	105747727	missense	probably benign	0.00
R6291:Tpp1	UTSW	7	105747016	missense	probably benign	0.05
R6422:Tpp1	UTSW	7	105746956	missense	probably benign	0.01
R6671:Tpp1	UTSW	7	105749607	missense	probably benign	0.19
R6841:Tpp1	UTSW	7	105748964	missense	probably damaging	0.96
R6851:Tpp1	UTSW	7	105749712	missense	probably damaging	1.00
R7022:Tpp1	UTSW	7	105748922	missense	probably damaging	1.00
R7106:Tpp1	UTSW	7	105749911	missense	possibly damaging	0.67
R7260:Tpp1	UTSW	7	105747497	missense	probably benign	0.00
R7485:Tpp1	UTSW	7	105749544	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATTTCAAGAACTGGGCCACTGC -3'
(R):5'- TCCCTTTTCCAGTAAGACCCAGACC -3'

Sequencing Primer
(F):5'- ACTGCTTCCTCCTGAAGGAC -3'
(R):5'- acccacgaccatcagcc -3'

Posted On

2014-05-09