Incidental Mutation 'R1751:Pik3c2a'
Institutional Source Beutler Lab
Gene Symbol Pik3c2a
Ensembl Gene ENSMUSG00000030660
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
MMRRC Submission 039783-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1751 (G1)
Quality Score225
Status Validated
Chromosomal Location116337265-116443449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 116346236 bp
Amino Acid Change Valine to Glycine at position 1445 (V1445G)
Ref Sequence ENSEMBL: ENSMUSP00000146181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]
Predicted Effect probably damaging
Transcript: ENSMUST00000170430
AA Change: V1445G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: V1445G

low complexity region 28 43 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
PI3K_rbd 410 513 3.08e-38 SMART
PI3K_C2 674 783 2.71e-34 SMART
PI3Ka 860 1047 3.62e-85 SMART
PI3Kc 1134 1396 3.1e-125 SMART
PX 1422 1534 5.68e-30 SMART
C2 1573 1677 3.93e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206219
AA Change: V1445G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206248
Predicted Effect probably benign
Transcript: ENSMUST00000206385
Meta Mutation Damage Score 0.6515 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bank1 G T 3: 136,234,614 R203S probably benign Het
Bank1 A G 3: 136,254,937 V53A probably benign Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cdc5l A T 17: 45,407,805 D628E probably benign Het
Chd3 G A 11: 69,353,901 probably benign Het
Clstn3 A T 6: 124,431,999 W860R probably damaging Het
Cntn4 G A 6: 106,618,410 probably null Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Cyp2b9 T C 7: 26,186,675 V89A probably benign Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gart A C 16: 91,642,949 probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gnas T A 2: 174,297,894 probably benign Het
Greb1 A G 12: 16,723,438 probably benign Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gucy2c A T 6: 136,748,775 probably benign Het
Igf2r A C 17: 12,697,441 S1677A possibly damaging Het
Jmjd1c T C 10: 67,225,690 L1274P probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrp6 A G 6: 134,464,568 L1145S probably damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Nol8 A T 13: 49,667,408 T914S probably benign Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr109 A T 17: 37,466,901 M232L probably benign Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pcp4 A C 16: 96,525,489 Q290P probably damaging Het
Pdlim1 C T 19: 40,251,904 probably benign Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Plxnc1 A G 10: 94,849,815 probably benign Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rfx2 A G 17: 56,784,754 V313A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Sbpl A G 17: 23,954,803 probably null Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Setbp1 T C 18: 78,857,398 D1018G probably damaging Het
Slc38a11 T A 2: 65,350,108 I182F probably benign Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Smarca2 T C 19: 26,640,380 probably benign Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Stox1 T C 10: 62,659,666 T943A probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Trpc7 T A 13: 56,776,143 D743V probably damaging Het
Trrap T C 5: 144,814,575 probably null Het
Tsc1 A G 2: 28,676,026 I485V probably damaging Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Tsr3 T C 17: 25,242,639 I317T possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r108 A T 17: 20,462,524 V806E probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zfp108 C A 7: 24,261,896 H637Q probably damaging Het
Other mutations in Pik3c2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Pik3c2a APN 7 116376283 missense possibly damaging 0.50
IGL00732:Pik3c2a APN 7 116364500 missense possibly damaging 0.82
IGL01303:Pik3c2a APN 7 116373803 missense possibly damaging 0.94
IGL01443:Pik3c2a APN 7 116418194 missense probably benign 0.01
IGL01462:Pik3c2a APN 7 116376250 missense possibly damaging 0.94
IGL01641:Pik3c2a APN 7 116350765 intron probably benign
IGL01695:Pik3c2a APN 7 116417518 missense possibly damaging 0.82
IGL02095:Pik3c2a APN 7 116346188 missense probably damaging 1.00
IGL02137:Pik3c2a APN 7 116350804 missense probably benign 0.00
IGL02160:Pik3c2a APN 7 116388064 missense probably damaging 1.00
IGL02224:Pik3c2a APN 7 116363340 splice site probably benign
IGL02345:Pik3c2a APN 7 116405891 missense probably damaging 1.00
IGL02644:Pik3c2a APN 7 116372814 missense probably benign 0.00
IGL02756:Pik3c2a APN 7 116364513 missense probably benign 0.01
IGL03339:Pik3c2a APN 7 116418021 missense possibly damaging 0.57
IGL03412:Pik3c2a APN 7 116417839 missense probably benign 0.21
R0046:Pik3c2a UTSW 7 116354072 missense probably damaging 1.00
R0387:Pik3c2a UTSW 7 116373744 missense probably damaging 1.00
R0501:Pik3c2a UTSW 7 116354055 missense probably damaging 1.00
R0650:Pik3c2a UTSW 7 116346247 splice site probably benign
R0991:Pik3c2a UTSW 7 116362045 critical splice donor site probably null
R1074:Pik3c2a UTSW 7 116350925 nonsense probably null
R1485:Pik3c2a UTSW 7 116417673 missense possibly damaging 0.50
R1495:Pik3c2a UTSW 7 116388065 missense probably benign 0.01
R1510:Pik3c2a UTSW 7 116388045 missense probably benign 0.00
R1654:Pik3c2a UTSW 7 116368848 missense probably benign 0.02
R1711:Pik3c2a UTSW 7 116417927 nonsense probably null
R1733:Pik3c2a UTSW 7 116418520 start codon destroyed possibly damaging 0.96
R1812:Pik3c2a UTSW 7 116417664 missense probably damaging 0.98
R1817:Pik3c2a UTSW 7 116376512 critical splice donor site probably null
R1826:Pik3c2a UTSW 7 116368117 missense probably benign
R1875:Pik3c2a UTSW 7 116417971 missense probably benign 0.35
R1995:Pik3c2a UTSW 7 116354006 missense probably damaging 1.00
R2007:Pik3c2a UTSW 7 116342237 missense probably damaging 1.00
R2009:Pik3c2a UTSW 7 116364503 missense probably damaging 1.00
R2013:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2014:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2015:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2027:Pik3c2a UTSW 7 116350822 missense probably damaging 1.00
R2050:Pik3c2a UTSW 7 116417451 critical splice donor site probably null
R2068:Pik3c2a UTSW 7 116372891 nonsense probably null
R3814:Pik3c2a UTSW 7 116348179 missense probably damaging 1.00
R3848:Pik3c2a UTSW 7 116364550 nonsense probably null
R4386:Pik3c2a UTSW 7 116354099 missense probably damaging 1.00
R4668:Pik3c2a UTSW 7 116358688 missense probably benign 0.16
R4783:Pik3c2a UTSW 7 116417825 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R5057:Pik3c2a UTSW 7 116376283 missense possibly damaging 0.50
R5080:Pik3c2a UTSW 7 116348274 missense probably damaging 1.00
R5083:Pik3c2a UTSW 7 116342401 missense probably damaging 1.00
R5144:Pik3c2a UTSW 7 116350786 missense probably benign 0.01
R5589:Pik3c2a UTSW 7 116417658 missense probably benign 0.02
R5646:Pik3c2a UTSW 7 116405951 missense probably damaging 1.00
R5829:Pik3c2a UTSW 7 116372814 missense probably benign 0.00
R5951:Pik3c2a UTSW 7 116368184 missense probably damaging 0.96
R5958:Pik3c2a UTSW 7 116362564 missense probably damaging 1.00
R6356:Pik3c2a UTSW 7 116348205 missense possibly damaging 0.46
R6551:Pik3c2a UTSW 7 116417496 missense probably damaging 0.97
R6641:Pik3c2a UTSW 7 116340225 critical splice acceptor site probably null
R6661:Pik3c2a UTSW 7 116368758 missense possibly damaging 0.77
R6789:Pik3c2a UTSW 7 116362184 missense probably damaging 1.00
R6874:Pik3c2a UTSW 7 116394305 missense probably damaging 1.00
R6985:Pik3c2a UTSW 7 116417988 missense probably damaging 0.98
R7106:Pik3c2a UTSW 7 116418133 nonsense probably null
R7153:Pik3c2a UTSW 7 116342252 missense probably damaging 1.00
R7176:Pik3c2a UTSW 7 116388096 missense possibly damaging 0.47
R7265:Pik3c2a UTSW 7 116388086 missense probably damaging 1.00
R7303:Pik3c2a UTSW 7 116405943 missense probably benign 0.00
R7308:Pik3c2a UTSW 7 116373839 missense probably damaging 1.00
R7375:Pik3c2a UTSW 7 116376386 missense probably damaging 1.00
R7406:Pik3c2a UTSW 7 116354007 missense probably damaging 1.00
R7426:Pik3c2a UTSW 7 116372854 missense probably damaging 1.00
R7528:Pik3c2a UTSW 7 116394239 missense probably damaging 1.00
R7539:Pik3c2a UTSW 7 116340096 missense probably damaging 0.97
R7684:Pik3c2a UTSW 7 116388077 nonsense probably null
R7737:Pik3c2a UTSW 7 116356253 missense probably damaging 0.99
R7739:Pik3c2a UTSW 7 116394294 missense probably benign 0.26
R7852:Pik3c2a UTSW 7 116417458 missense probably benign
R7922:Pik3c2a UTSW 7 116391282 missense probably damaging 1.00
R7956:Pik3c2a UTSW 7 116350115 missense probably benign 0.01
R8005:Pik3c2a UTSW 7 116418036 missense probably damaging 1.00
R8158:Pik3c2a UTSW 7 116342997 missense probably benign 0.00
R8329:Pik3c2a UTSW 7 116418048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGAGCAAGcagaggtcctaaa -3'

Sequencing Primer
(F):5'- tcctaaattcaattcccaacaacc -3'
Posted On2014-05-23