Incidental Mutation 'R1782:Kmt2d'
ID 195433
Institutional Source Beutler Lab
Gene Symbol Kmt2d
Ensembl Gene ENSMUSG00000048154
Gene Name lysine (K)-specific methyltransferase 2D
Synonyms Mll2, C430014K11Rik, Mll4
MMRRC Submission 039813-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1782 (G1)
Quality Score 173
Status Not validated
Chromosome 15
Chromosomal Location 98831669-98871204 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 98857548 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486] [ENSMUST00000184363]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000023741
AA Change: Q1513L
SMART Domains Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154
AA Change: Q1513L

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178486
AA Change: Q1513L
SMART Domains Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154
AA Change: Q1513L

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184363
SMART Domains Protein: ENSMUSP00000139020
Gene: ENSMUSG00000048154

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,688 I47V probably benign Het
9330182L06Rik A T 5: 9,421,620 K320N possibly damaging Het
Abca13 A T 11: 9,297,971 T2573S probably benign Het
Adgra3 G T 5: 49,972,062 T738K probably benign Het
Adgrl4 C T 3: 151,542,805 Q705* probably null Het
Atp2b1 T G 10: 99,003,201 D630E probably benign Het
Atp2c1 G A 9: 105,431,587 R577C probably damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
C8g T A 2: 25,499,082 D163V possibly damaging Het
Catsper1 T C 19: 5,335,909 Y57H probably benign Het
Ccdc25 C T 14: 65,854,148 A72V probably benign Het
Cdca2 T G 14: 67,677,811 E666D probably benign Het
Cdh23 G A 10: 60,488,542 T313I probably damaging Het
Cfap57 C A 4: 118,614,975 R69L probably damaging Het
Chat C A 14: 32,408,987 V566L probably damaging Het
Cntn3 T C 6: 102,273,811 I259V probably damaging Het
Cog1 A G 11: 113,653,966 T325A probably benign Het
Cxcl10 A G 5: 92,347,803 *94Q probably null Het
Cyp4a12b T C 4: 115,433,981 Y369H probably damaging Het
Dhx33 T C 11: 71,001,640 Y101C probably damaging Het
Dock6 A G 9: 21,811,846 M1593T probably damaging Het
Dpy19l3 T C 7: 35,708,155 T488A possibly damaging Het
Fam198b T C 3: 79,886,531 L102S possibly damaging Het
Fbxw14 A G 9: 109,278,691 I205T possibly damaging Het
Fbxw7 T C 3: 84,903,819 F84L probably benign Het
Flii T C 11: 60,714,636 T1212A probably benign Het
Fosl1 T A 19: 5,450,182 I43N probably damaging Het
Gabrr2 G A 4: 33,085,593 A338T probably damaging Het
Gatad2b T C 3: 90,341,871 V72A probably benign Het
Gorasp1 G T 9: 119,932,822 N48K probably damaging Het
Gramd1b C A 9: 40,413,337 D139Y probably damaging Het
Gtf3c1 A T 7: 125,667,074 V1030E probably damaging Het
H2afy A T 13: 56,074,321 M339K probably damaging Het
Havcr2 C T 11: 46,455,017 T6I unknown Het
Hgs A G 11: 120,478,505 E340G probably damaging Het
Irx2 A G 13: 72,631,466 T290A probably benign Het
Itgb8 T A 12: 119,192,118 I200F probably damaging Het
Josd2 A G 7: 44,471,153 I105V probably damaging Het
Kcnh7 T A 2: 62,736,169 D806V probably damaging Het
Kctd8 A G 5: 69,340,976 V109A possibly damaging Het
Krtap2-4 A T 11: 99,614,527 V86E probably damaging Het
Lgr6 C G 1: 134,987,979 V344L probably damaging Het
Lime1 A T 2: 181,383,056 R168W possibly damaging Het
Magel2 C T 7: 62,380,857 Q1170* probably null Het
Ndufaf3 A T 9: 108,566,011 I169N probably damaging Het
Neb T A 2: 52,284,345 K1501* probably null Het
Nim1k A T 13: 119,712,151 S402R probably benign Het
Nt5dc2 T G 14: 31,138,201 S395R probably damaging Het
Oaz2 G T 9: 65,688,861 V132L probably benign Het
Olfr1089 T C 2: 86,732,682 K310R probably benign Het
Olfr1457 T A 19: 13,094,803 I282F probably damaging Het
Olfr315 T A 11: 58,778,805 L226H probably damaging Het
Olfr723 A T 14: 49,928,639 W302R probably benign Het
Olfr843 C T 9: 19,248,581 V273I probably benign Het
Pfkl A G 10: 77,988,720 V717A probably benign Het
Phgdh C T 3: 98,320,747 V231I probably damaging Het
Pkhd1 A T 1: 20,565,711 M465K probably damaging Het
Ppp3r1 A G 11: 17,198,281 H163R probably benign Het
Prune2 T A 19: 17,122,173 N1680K probably benign Het
Puf60 T A 15: 76,071,875 I216L probably benign Het
Rev3l T A 10: 39,799,885 N190K probably benign Het
Rp1 G A 1: 4,349,089 S600L probably benign Het
Rpl3l A G 17: 24,733,456 I217V probably benign Het
Scly T A 1: 91,308,380 V194D probably damaging Het
Scnn1b A G 7: 121,917,961 T607A probably benign Het
Slc13a3 G A 2: 165,445,519 L172F probably benign Het
Sorbs2 A G 8: 45,805,696 Y1090C probably damaging Het
Spag17 T A 3: 100,010,754 M351K probably benign Het
St14 A G 9: 31,100,164 Y444H probably damaging Het
Taf8 C A 17: 47,498,211 A109S probably benign Het
Tbc1d30 T A 10: 121,267,620 K502N probably damaging Het
Them5 T C 3: 94,344,489 S136P probably benign Het
Tmem248 T A 5: 130,231,928 N111K probably damaging Het
Tmem74 C A 15: 43,866,952 V232L probably damaging Het
Tnip2 A T 5: 34,499,668 H264Q probably benign Het
Trim5 A G 7: 104,265,816 probably null Het
Trim63 A G 4: 134,323,038 Q211R probably benign Het
Trrap T C 5: 144,822,703 V2231A possibly damaging Het
Ttn T C 2: 76,735,487 S28174G probably benign Het
Ugt2b36 T C 5: 87,081,581 D341G possibly damaging Het
Uroc1 G A 6: 90,336,919 E63K probably damaging Het
Ush2a T C 1: 188,911,185 V4248A probably benign Het
Usp1 A G 4: 98,934,198 H583R probably damaging Het
Usp8 T A 2: 126,720,051 F55Y probably damaging Het
Vmn2r13 T A 5: 109,158,174 T513S probably benign Het
Wdr73 T C 7: 80,891,778 T339A probably damaging Het
Wnt2 T A 6: 18,008,640 N266I possibly damaging Het
Wwp2 AGAACT A 8: 107,506,399 probably null Het
Other mutations in Kmt2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Kmt2d APN 15 98862333 missense unknown
IGL00927:Kmt2d APN 15 98845009 unclassified probably benign
IGL01123:Kmt2d APN 15 98837148 missense unknown
IGL01288:Kmt2d APN 15 98865044 missense probably damaging 1.00
IGL01538:Kmt2d APN 15 98860657 unclassified probably benign
IGL01575:Kmt2d APN 15 98846855 utr 3 prime probably benign
IGL01584:Kmt2d APN 15 98856369 unclassified probably benign
IGL01750:Kmt2d APN 15 98853168 unclassified probably benign
IGL02163:Kmt2d APN 15 98835228 unclassified probably benign
IGL02209:Kmt2d APN 15 98854567 unclassified probably benign
IGL02253:Kmt2d APN 15 98858175 unclassified probably benign
IGL02271:Kmt2d APN 15 98866428 missense possibly damaging 0.89
IGL02291:Kmt2d APN 15 98865492 splice site probably benign
IGL02448:Kmt2d APN 15 98844110 unclassified probably benign
IGL02472:Kmt2d APN 15 98850077 missense probably benign 0.23
IGL02496:Kmt2d APN 15 98857558 unclassified probably benign
IGL02527:Kmt2d APN 15 98841747 unclassified probably benign
IGL02576:Kmt2d APN 15 98864120 missense unknown
IGL02597:Kmt2d APN 15 98863831 missense unknown
IGL02609:Kmt2d APN 15 98851793 unclassified probably benign
IGL03085:Kmt2d APN 15 98839940 unclassified probably benign
IGL03102:Kmt2d APN 15 98855543 missense probably benign
IGL03123:Kmt2d APN 15 98861771 missense unknown
G1citation:Kmt2d UTSW 15 98849459 unclassified probably benign
R0091:Kmt2d UTSW 15 98844479 unclassified probably benign
R0136:Kmt2d UTSW 15 98854278 unclassified probably benign
R0243:Kmt2d UTSW 15 98850137 unclassified probably benign
R0276:Kmt2d UTSW 15 98850311 unclassified probably benign
R0477:Kmt2d UTSW 15 98853581 unclassified probably benign
R0478:Kmt2d UTSW 15 98853581 unclassified probably benign
R0586:Kmt2d UTSW 15 98835207 unclassified probably benign
R0632:Kmt2d UTSW 15 98853581 unclassified probably benign
R0678:Kmt2d UTSW 15 98850413 unclassified probably benign
R0780:Kmt2d UTSW 15 98862857 missense unknown
R0891:Kmt2d UTSW 15 98852691 unclassified probably benign
R1136:Kmt2d UTSW 15 98857765 unclassified probably benign
R1417:Kmt2d UTSW 15 98866430 missense probably damaging 0.99
R1499:Kmt2d UTSW 15 98844938 unclassified probably benign
R1510:Kmt2d UTSW 15 98856377 unclassified probably benign
R1586:Kmt2d UTSW 15 98865053 splice site probably benign
R1640:Kmt2d UTSW 15 98845057 unclassified probably benign
R1714:Kmt2d UTSW 15 98862950 missense unknown
R1725:Kmt2d UTSW 15 98845234 unclassified probably benign
R1728:Kmt2d UTSW 15 98865132 missense probably damaging 1.00
R1729:Kmt2d UTSW 15 98865132 missense probably damaging 1.00
R1741:Kmt2d UTSW 15 98845234 unclassified probably benign
R1744:Kmt2d UTSW 15 98865047 missense probably damaging 0.99
R1746:Kmt2d UTSW 15 98864378 missense probably damaging 0.97
R1753:Kmt2d UTSW 15 98843482 unclassified probably benign
R1789:Kmt2d UTSW 15 98852074 unclassified probably benign
R1802:Kmt2d UTSW 15 98862985 missense unknown
R1808:Kmt2d UTSW 15 98866686 missense probably damaging 1.00
R1822:Kmt2d UTSW 15 98861780 missense unknown
R1831:Kmt2d UTSW 15 98855343 missense probably damaging 0.97
R1920:Kmt2d UTSW 15 98855590 missense probably damaging 0.96
R1920:Kmt2d UTSW 15 98855591 missense probably damaging 1.00
R1956:Kmt2d UTSW 15 98859590 unclassified probably benign
R2100:Kmt2d UTSW 15 98846480 unclassified probably benign
R2120:Kmt2d UTSW 15 98839529 unclassified probably benign
R2188:Kmt2d UTSW 15 98839300 unclassified probably benign
R2191:Kmt2d UTSW 15 98861049 critical splice donor site probably null
R2234:Kmt2d UTSW 15 98865248 missense probably damaging 0.98
R2422:Kmt2d UTSW 15 98862266 missense unknown
R2762:Kmt2d UTSW 15 98852055 unclassified probably benign
R2895:Kmt2d UTSW 15 98843939 unclassified probably benign
R3624:Kmt2d UTSW 15 98842902 unclassified probably benign
R3791:Kmt2d UTSW 15 98844149 unclassified probably benign
R3794:Kmt2d UTSW 15 98837359 unclassified probably benign
R3871:Kmt2d UTSW 15 98851021 unclassified probably benign
R3958:Kmt2d UTSW 15 98855549 missense possibly damaging 0.69
R3983:Kmt2d UTSW 15 98846046 unclassified probably benign
R4211:Kmt2d UTSW 15 98840189 unclassified probably benign
R4212:Kmt2d UTSW 15 98845003 unclassified probably benign
R4240:Kmt2d UTSW 15 98844571 unclassified probably benign
R4246:Kmt2d UTSW 15 98840089 unclassified probably benign
R4361:Kmt2d UTSW 15 98863670 missense unknown
R4388:Kmt2d UTSW 15 98853626 unclassified probably benign
R4602:Kmt2d UTSW 15 98850259 unclassified probably benign
R4606:Kmt2d UTSW 15 98839716 unclassified probably benign
R4658:Kmt2d UTSW 15 98852529 unclassified probably benign
R4840:Kmt2d UTSW 15 98861894 missense unknown
R4895:Kmt2d UTSW 15 98844487 unclassified probably benign
R4906:Kmt2d UTSW 15 98849539 unclassified probably benign
R4976:Kmt2d UTSW 15 98847194 utr 3 prime probably benign
R5093:Kmt2d UTSW 15 98856162 missense probably damaging 1.00
R5119:Kmt2d UTSW 15 98847194 utr 3 prime probably benign
R5160:Kmt2d UTSW 15 98840224 unclassified probably benign
R5260:Kmt2d UTSW 15 98842860 unclassified probably benign
R5274:Kmt2d UTSW 15 98854230 unclassified probably benign
R5450:Kmt2d UTSW 15 98855086 missense probably damaging 1.00
R5461:Kmt2d UTSW 15 98852109 unclassified probably benign
R5462:Kmt2d UTSW 15 98852109 unclassified probably benign
R5463:Kmt2d UTSW 15 98852109 unclassified probably benign
R5465:Kmt2d UTSW 15 98852109 unclassified probably benign
R5467:Kmt2d UTSW 15 98852109 unclassified probably benign
R5481:Kmt2d UTSW 15 98862005 missense unknown
R5509:Kmt2d UTSW 15 98839676 unclassified probably benign
R5534:Kmt2d UTSW 15 98837357 unclassified probably benign
R5536:Kmt2d UTSW 15 98852109 unclassified probably benign
R5537:Kmt2d UTSW 15 98852109 unclassified probably benign
R5538:Kmt2d UTSW 15 98852109 unclassified probably benign
R5546:Kmt2d UTSW 15 98853068 unclassified probably benign
R5595:Kmt2d UTSW 15 98850024 unclassified probably benign
R5645:Kmt2d UTSW 15 98844397 unclassified probably benign
R5679:Kmt2d UTSW 15 98854272 unclassified probably benign
R5710:Kmt2d UTSW 15 98854106 unclassified probably benign
R5755:Kmt2d UTSW 15 98863646 missense unknown
R5817:Kmt2d UTSW 15 98862363 missense unknown
R5841:Kmt2d UTSW 15 98852109 unclassified probably benign
R5842:Kmt2d UTSW 15 98852109 unclassified probably benign
R5843:Kmt2d UTSW 15 98852109 unclassified probably benign
R5844:Kmt2d UTSW 15 98852109 unclassified probably benign
R5845:Kmt2d UTSW 15 98852109 unclassified probably benign
R6122:Kmt2d UTSW 15 98860692 unclassified probably benign
R6612:Kmt2d UTSW 15 98845858 unclassified probably benign
R6718:Kmt2d UTSW 15 98849586 unclassified probably benign
R6718:Kmt2d UTSW 15 98850539 unclassified probably benign
R6822:Kmt2d UTSW 15 98849459 unclassified probably benign
R6866:Kmt2d UTSW 15 98857393 unclassified probably benign
R6950:Kmt2d UTSW 15 98840020 unclassified probably benign
R7089:Kmt2d UTSW 15 98850272 missense unknown
R7120:Kmt2d UTSW 15 98861065 missense unknown
R7131:Kmt2d UTSW 15 98849616 unclassified probably benign
R7177:Kmt2d UTSW 15 98850386 missense unknown
R7194:Kmt2d UTSW 15 98843833 missense unknown
R7252:Kmt2d UTSW 15 98844266 missense unknown
R7282:Kmt2d UTSW 15 98854104 missense unknown
R7307:Kmt2d UTSW 15 98849418 missense unknown
R7313:Kmt2d UTSW 15 98856623 missense unknown
R7394:Kmt2d UTSW 15 98856384 missense unknown
R7404:Kmt2d UTSW 15 98845495 missense unknown
R7409:Kmt2d UTSW 15 98855354 missense probably damaging 1.00
R7414:Kmt2d UTSW 15 98839856 missense unknown
R7534:Kmt2d UTSW 15 98852018 missense unknown
R7575:Kmt2d UTSW 15 98849611 unclassified probably benign
R7650:Kmt2d UTSW 15 98850870 missense unknown
R7687:Kmt2d UTSW 15 98862120 missense unknown
R7699:Kmt2d UTSW 15 98843719 missense unknown
R7700:Kmt2d UTSW 15 98843719 missense unknown
R7765:Kmt2d UTSW 15 98852334 missense unknown
R7797:Kmt2d UTSW 15 98864406 missense probably benign 0.24
R7803:Kmt2d UTSW 15 98862923 missense unknown
R7952:Kmt2d UTSW 15 98850768 missense unknown
R8054:Kmt2d UTSW 15 98843925 missense unknown
R8084:Kmt2d UTSW 15 98842064 missense unknown
R8089:Kmt2d UTSW 15 98842869 missense unknown
R8133:Kmt2d UTSW 15 98864942 missense probably damaging 1.00
R8138:Kmt2d UTSW 15 98843653 missense unknown
R8343:Kmt2d UTSW 15 98852597 missense unknown
R8681:Kmt2d UTSW 15 98846067 missense unknown
R8694:Kmt2d UTSW 15 98844734 missense unknown
R8837:Kmt2d UTSW 15 98864167 missense unknown
R8855:Kmt2d UTSW 15 98856356 missense unknown
R8934:Kmt2d UTSW 15 98861886 missense unknown
R9100:Kmt2d UTSW 15 98849951 missense unknown
R9158:Kmt2d UTSW 15 98843139 missense unknown
R9190:Kmt2d UTSW 15 98852015 missense unknown
R9222:Kmt2d UTSW 15 98849443 missense unknown
R9263:Kmt2d UTSW 15 98849618 frame shift probably null
R9336:Kmt2d UTSW 15 98845816 missense unknown
R9397:Kmt2d UTSW 15 98850113 missense unknown
R9415:Kmt2d UTSW 15 98839705 missense unknown
R9482:Kmt2d UTSW 15 98865165 missense probably damaging 1.00
R9529:Kmt2d UTSW 15 98839768 missense unknown
R9610:Kmt2d UTSW 15 98845176 unclassified probably benign
R9611:Kmt2d UTSW 15 98845173 unclassified probably benign
R9611:Kmt2d UTSW 15 98845176 unclassified probably benign
R9612:Kmt2d UTSW 15 98845176 unclassified probably benign
R9613:Kmt2d UTSW 15 98845176 unclassified probably benign
R9644:Kmt2d UTSW 15 98845504 missense unknown
R9716:Kmt2d UTSW 15 98843402 missense unknown
R9763:Kmt2d UTSW 15 98845176 unclassified probably benign
R9782:Kmt2d UTSW 15 98866716 missense probably damaging 1.00
X0018:Kmt2d UTSW 15 98852922 unclassified probably benign
X0024:Kmt2d UTSW 15 98853053 unclassified probably benign
X0062:Kmt2d UTSW 15 98849819 unclassified probably benign
Z1187:Kmt2d UTSW 15 98851744 missense unknown
Z1188:Kmt2d UTSW 15 98851744 missense unknown
Z1189:Kmt2d UTSW 15 98851744 missense unknown
Z1190:Kmt2d UTSW 15 98851744 missense unknown
Z1192:Kmt2d UTSW 15 98851744 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAAGCCGTGCTCTCTTGAATGAG -3'
(R):5'- AAGACCTGCTAATCCAGTGTCGCC -3'

Sequencing Primer
(F):5'- tctaatcataactttgccactgac -3'
(R):5'- AATCCAGTGTCGCCACTGTG -3'
Posted On 2014-05-23