Incidental Mutation 'R1782:Spag17'
ID195364
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Namesperm associated antigen 17
Synonyms4931427F14Rik, PF6
MMRRC Submission 039813-MU
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1782 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location99885406-100143322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100010754 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 351 (M351K)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119462
Predicted Effect probably benign
Transcript: ENSMUST00000164539
AA Change: M351K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: M351K

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,688 I47V probably benign Het
9330182L06Rik A T 5: 9,421,620 K320N possibly damaging Het
Abca13 A T 11: 9,297,971 T2573S probably benign Het
Adgra3 G T 5: 49,972,062 T738K probably benign Het
Adgrl4 C T 3: 151,542,805 Q705* probably null Het
Atp2b1 T G 10: 99,003,201 D630E probably benign Het
Atp2c1 G A 9: 105,431,587 R577C probably damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
C8g T A 2: 25,499,082 D163V possibly damaging Het
Catsper1 T C 19: 5,335,909 Y57H probably benign Het
Ccdc25 C T 14: 65,854,148 A72V probably benign Het
Cdca2 T G 14: 67,677,811 E666D probably benign Het
Cdh23 G A 10: 60,488,542 T313I probably damaging Het
Cfap57 C A 4: 118,614,975 R69L probably damaging Het
Chat C A 14: 32,408,987 V566L probably damaging Het
Cntn3 T C 6: 102,273,811 I259V probably damaging Het
Cog1 A G 11: 113,653,966 T325A probably benign Het
Cxcl10 A G 5: 92,347,803 *94Q probably null Het
Cyp4a12b T C 4: 115,433,981 Y369H probably damaging Het
Dhx33 T C 11: 71,001,640 Y101C probably damaging Het
Dock6 A G 9: 21,811,846 M1593T probably damaging Het
Dpy19l3 T C 7: 35,708,155 T488A possibly damaging Het
Fam198b T C 3: 79,886,531 L102S possibly damaging Het
Fbxw14 A G 9: 109,278,691 I205T possibly damaging Het
Fbxw7 T C 3: 84,903,819 F84L probably benign Het
Flii T C 11: 60,714,636 T1212A probably benign Het
Fosl1 T A 19: 5,450,182 I43N probably damaging Het
Gabrr2 G A 4: 33,085,593 A338T probably damaging Het
Gatad2b T C 3: 90,341,871 V72A probably benign Het
Gorasp1 G T 9: 119,932,822 N48K probably damaging Het
Gramd1b C A 9: 40,413,337 D139Y probably damaging Het
Gtf3c1 A T 7: 125,667,074 V1030E probably damaging Het
H2afy A T 13: 56,074,321 M339K probably damaging Het
Havcr2 C T 11: 46,455,017 T6I unknown Het
Hgs A G 11: 120,478,505 E340G probably damaging Het
Irx2 A G 13: 72,631,466 T290A probably benign Het
Itgb8 T A 12: 119,192,118 I200F probably damaging Het
Josd2 A G 7: 44,471,153 I105V probably damaging Het
Kcnh7 T A 2: 62,736,169 D806V probably damaging Het
Kctd8 A G 5: 69,340,976 V109A possibly damaging Het
Kmt2d T A 15: 98,857,548 probably benign Het
Krtap2-4 A T 11: 99,614,527 V86E probably damaging Het
Lgr6 C G 1: 134,987,979 V344L probably damaging Het
Lime1 A T 2: 181,383,056 R168W possibly damaging Het
Magel2 C T 7: 62,380,857 Q1170* probably null Het
Ndufaf3 A T 9: 108,566,011 I169N probably damaging Het
Neb T A 2: 52,284,345 K1501* probably null Het
Nim1k A T 13: 119,712,151 S402R probably benign Het
Nt5dc2 T G 14: 31,138,201 S395R probably damaging Het
Oaz2 G T 9: 65,688,861 V132L probably benign Het
Olfr1089 T C 2: 86,732,682 K310R probably benign Het
Olfr1457 T A 19: 13,094,803 I282F probably damaging Het
Olfr315 T A 11: 58,778,805 L226H probably damaging Het
Olfr723 A T 14: 49,928,639 W302R probably benign Het
Olfr843 C T 9: 19,248,581 V273I probably benign Het
Pfkl A G 10: 77,988,720 V717A probably benign Het
Phgdh C T 3: 98,320,747 V231I probably damaging Het
Pkhd1 A T 1: 20,565,711 M465K probably damaging Het
Ppp3r1 A G 11: 17,198,281 H163R probably benign Het
Prune2 T A 19: 17,122,173 N1680K probably benign Het
Puf60 T A 15: 76,071,875 I216L probably benign Het
Rev3l T A 10: 39,799,885 N190K probably benign Het
Rp1 G A 1: 4,349,089 S600L probably benign Het
Rpl3l A G 17: 24,733,456 I217V probably benign Het
Scly T A 1: 91,308,380 V194D probably damaging Het
Scnn1b A G 7: 121,917,961 T607A probably benign Het
Slc13a3 G A 2: 165,445,519 L172F probably benign Het
Sorbs2 A G 8: 45,805,696 Y1090C probably damaging Het
St14 A G 9: 31,100,164 Y444H probably damaging Het
Taf8 C A 17: 47,498,211 A109S probably benign Het
Tbc1d30 T A 10: 121,267,620 K502N probably damaging Het
Them5 T C 3: 94,344,489 S136P probably benign Het
Tmem248 T A 5: 130,231,928 N111K probably damaging Het
Tmem74 C A 15: 43,866,952 V232L probably damaging Het
Tnip2 A T 5: 34,499,668 H264Q probably benign Het
Trim5 A G 7: 104,265,816 probably null Het
Trim63 A G 4: 134,323,038 Q211R probably benign Het
Trrap T C 5: 144,822,703 V2231A possibly damaging Het
Ttn T C 2: 76,735,487 S28174G probably benign Het
Ugt2b36 T C 5: 87,081,581 D341G possibly damaging Het
Uroc1 G A 6: 90,336,919 E63K probably damaging Het
Ush2a T C 1: 188,911,185 V4248A probably benign Het
Usp1 A G 4: 98,934,198 H583R probably damaging Het
Usp8 T A 2: 126,720,051 F55Y probably damaging Het
Vmn2r13 T A 5: 109,158,174 T513S probably benign Het
Wdr73 T C 7: 80,891,778 T339A probably damaging Het
Wnt2 T A 6: 18,008,640 N266I possibly damaging Het
Wwp2 AGAACT A 8: 107,506,399 probably null Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
PIT4504001:Spag17 UTSW 3 100103110 critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 100013211 missense possibly damaging 0.53
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99984609 missense probably benign 0.00
R7084:Spag17 UTSW 3 99939270 missense probably benign 0.18
R7126:Spag17 UTSW 3 100101435 missense probably benign 0.00
R7144:Spag17 UTSW 3 100027401 splice site probably null
R7198:Spag17 UTSW 3 100095572 missense probably benign 0.02
R7318:Spag17 UTSW 3 99939983 missense probably benign 0.00
R7403:Spag17 UTSW 3 99939375 missense possibly damaging 0.53
R7409:Spag17 UTSW 3 100027231 missense possibly damaging 0.73
R7409:Spag17 UTSW 3 100034159 missense probably benign 0.00
R7537:Spag17 UTSW 3 99939247 missense possibly damaging 0.96
R7609:Spag17 UTSW 3 100095595 nonsense probably null
R7772:Spag17 UTSW 3 100080118 missense probably damaging 0.98
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CATTATGGTACTGGACAGCGTCAGAAC -3'
(R):5'- TCACTCCATCCCCAAGATGATGATAGG -3'

Sequencing Primer
(F):5'- ACAGCGTCAGAACCTCTGTG -3'
(R):5'- ATAGGTACGAGAGTCCATGCTTC -3'
Posted On2014-05-23