Incidental Mutation 'R7575:Kmt2d'
ID 586376
Institutional Source Beutler Lab
Gene Symbol Kmt2d
Ensembl Gene ENSMUSG00000048154
Gene Name lysine (K)-specific methyltransferase 2D
Synonyms Mll2, C430014K11Rik, Mll4
MMRRC Submission 045632-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7575 (G1)
Quality Score 217.468
Status Not validated
Chromosome 15
Chromosomal Location 98831669-98871204 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) CTGCTGCTG to CTGCTGCTGATGCTGCTG at 98849611 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023741
SMART Domains Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178486
SMART Domains Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229651
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,662,632 (GRCm38) V459I probably benign Het
4921539E11Rik T C 4: 103,230,995 (GRCm38) D439G probably damaging Het
Adam18 T C 8: 24,625,857 (GRCm38) N607S possibly damaging Het
Adamtsl3 A T 7: 82,574,548 (GRCm38) N1179I possibly damaging Het
Adarb1 A G 10: 77,303,295 (GRCm38) F552S probably damaging Het
Ago1 T C 4: 126,453,908 (GRCm38) E394G probably benign Het
Alb G A 5: 90,465,929 (GRCm38) C224Y probably damaging Het
Alms1 T A 6: 85,622,159 (GRCm38) H1322Q possibly damaging Het
Arhgef18 T G 8: 3,451,635 (GRCm38) V643G probably damaging Het
Asah2 T C 19: 32,016,703 (GRCm38) Q414R probably benign Het
Atpsckmt C T 15: 31,606,040 (GRCm38) A48V probably damaging Het
Bbc3 G A 7: 16,312,367 (GRCm38) R76H possibly damaging Het
Bub1b T A 2: 118,641,158 (GRCm38) S1000T possibly damaging Het
Bud23 A T 5: 135,061,128 (GRCm38) Y70* probably null Het
C1d A G 11: 17,262,694 (GRCm38) E13G probably damaging Het
Camk1 T A 6: 113,338,364 (GRCm38) I158F probably damaging Het
Ccr2 A C 9: 124,105,806 (GRCm38) D41A probably benign Het
Cdh18 G T 15: 23,400,597 (GRCm38) E348* probably null Het
Col6a3 A G 1: 90,810,599 (GRCm38) L1066P possibly damaging Het
Cyp11b1 T A 15: 74,839,313 (GRCm38) D172V probably benign Het
Cyp2j8 A G 4: 96,470,548 (GRCm38) I378T possibly damaging Het
Cys1 T A 12: 24,668,648 (GRCm38) K69* probably null Het
Dip2c A G 13: 9,628,012 (GRCm38) K1165E probably damaging Het
Drd3 A T 16: 43,817,133 (GRCm38) I232F probably benign Het
Dusp7 T C 9: 106,373,677 (GRCm38) C334R probably damaging Het
Eppk1 A G 15: 76,111,242 (GRCm38) S480P not run Het
Erc1 G T 6: 119,824,760 (GRCm38) P99T possibly damaging Het
Fam170b C T 14: 32,836,198 (GRCm38) P330L unknown Het
Fasn G T 11: 120,812,687 (GRCm38) T1573K possibly damaging Het
Fras1 A T 5: 96,543,314 (GRCm38) T130S probably benign Het
Fzd4 A G 7: 89,407,710 (GRCm38) I322V possibly damaging Het
Gbp10 G A 5: 105,236,149 (GRCm38) probably benign Het
Gdpd4 A T 7: 97,998,241 (GRCm38) H365L probably benign Het
Gfy A G 7: 45,178,100 (GRCm38) S191P probably benign Het
Ghr A T 15: 3,320,512 (GRCm38) S395T probably damaging Het
Git2 C T 5: 114,766,489 (GRCm38) R123H probably damaging Het
Htt A G 5: 34,905,643 (GRCm38) D2873G probably damaging Het
Idua A T 5: 108,681,699 (GRCm38) D476V probably damaging Het
Inppl1 G A 7: 101,828,482 (GRCm38) R683W probably damaging Het
Ipp T C 4: 116,532,644 (GRCm38) S466P probably benign Het
Iqgap2 A G 13: 95,661,623 (GRCm38) V1058A probably damaging Het
Jmy A T 13: 93,464,595 (GRCm38) Y434* probably null Het
Mogs T G 6: 83,115,835 (GRCm38) S85R probably damaging Het
Mroh2b A T 15: 4,934,605 (GRCm38) D863V probably damaging Het
Mtmr10 A T 7: 64,297,465 (GRCm38) I43F probably damaging Het
Mtr T C 13: 12,199,077 (GRCm38) D903G probably benign Het
Ncor1 A G 11: 62,383,256 (GRCm38) V186A probably benign Het
Notch3 C T 17: 32,154,819 (GRCm38) D472N possibly damaging Het
Or4k44 A T 2: 111,538,252 (GRCm38) F12L probably damaging Het
Or6c68 T C 10: 129,321,859 (GRCm38) F79L probably damaging Het
Or8j3c A G 2: 86,423,238 (GRCm38) F146S probably benign Het
Or9i1 T C 19: 13,862,017 (GRCm38) S75P probably damaging Het
Oxr1 T G 15: 41,823,362 (GRCm38) L547V possibly damaging Het
Pappa2 A T 1: 158,814,530 (GRCm38) C1319S probably damaging Het
Papss1 A C 3: 131,643,096 (GRCm38) K623N probably damaging Het
Parp4 T C 14: 56,637,918 (GRCm38) F1198S probably benign Het
Pcare T A 17: 71,750,855 (GRCm38) Q609L probably damaging Het
Pcnt A T 10: 76,389,252 (GRCm38) V1806D probably benign Het
Pitx2 A T 3: 129,215,726 (GRCm38) H98L probably damaging Het
Polq C A 16: 37,091,134 (GRCm38) D2410E probably benign Het
Prdm9 C T 17: 15,544,628 (GRCm38) C630Y probably damaging Het
Preb A T 5: 30,958,495 (GRCm38) D201E probably damaging Het
Rasa3 A T 8: 13,595,887 (GRCm38) I151N possibly damaging Het
Rasgrp2 T A 19: 6,404,367 (GRCm38) S147T probably damaging Het
Rev3l A G 10: 39,821,445 (GRCm38) D646G possibly damaging Het
Sdc1 A G 12: 8,790,619 (GRCm38) E128G probably damaging Het
Slamf7 A C 1: 171,639,194 (GRCm38) C148G probably damaging Het
Slc19a2 T C 1: 164,257,122 (GRCm38) S194P probably damaging Het
Spata31 C T 13: 64,922,912 (GRCm38) P958L unknown Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 (GRCm38) probably benign Het
Stradb A G 1: 58,988,580 (GRCm38) I90V probably benign Het
Tas2r134 A G 2: 51,628,154 (GRCm38) D215G probably damaging Het
Tbc1d4 T C 14: 101,447,589 (GRCm38) K1209E probably damaging Het
Thbs1 A G 2: 118,122,928 (GRCm38) D942G probably damaging Het
Tmem107 C T 11: 69,072,807 (GRCm38) P139S probably benign Het
Tmem216 A T 19: 10,551,902 (GRCm38) M40K probably benign Het
Tpte A G 8: 22,355,482 (GRCm38) Y516C probably damaging Het
Trim54 G A 5: 31,134,087 (GRCm38) G184D possibly damaging Het
Try5 A T 6: 41,311,814 (GRCm38) L157Q probably benign Het
Ubqlnl G A 7: 104,148,490 (GRCm38) A600V probably damaging Het
Uhrf2 C A 19: 30,071,368 (GRCm38) P258Q probably damaging Het
Ush2a A T 1: 188,822,688 (GRCm38) E3554D possibly damaging Het
Usp40 A C 1: 87,949,960 (GRCm38) L1158W probably damaging Het
Vmn1r121 T A 7: 21,098,273 (GRCm38) R81* probably null Het
Vmn1r203 C A 13: 22,524,418 (GRCm38) T123K probably benign Het
Vmn2r101 T C 17: 19,611,392 (GRCm38) V550A probably benign Het
Wdr49 A T 3: 75,450,886 (GRCm38) M184K probably damaging Het
Wipi2 A G 5: 142,658,232 (GRCm38) N123S probably damaging Het
Zbtb14 T C 17: 69,387,447 (GRCm38) F47L probably damaging Het
Zc3h7b C A 15: 81,777,885 (GRCm38) S385* probably null Het
Zhx2 T A 15: 57,823,262 (GRCm38) F676I probably damaging Het
Other mutations in Kmt2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Kmt2d APN 15 98,862,333 (GRCm38) missense unknown
IGL00927:Kmt2d APN 15 98,845,009 (GRCm38) unclassified probably benign
IGL01123:Kmt2d APN 15 98,837,148 (GRCm38) missense unknown
IGL01288:Kmt2d APN 15 98,865,044 (GRCm38) missense probably damaging 1.00
IGL01538:Kmt2d APN 15 98,860,657 (GRCm38) unclassified probably benign
IGL01575:Kmt2d APN 15 98,846,855 (GRCm38) utr 3 prime probably benign
IGL01584:Kmt2d APN 15 98,856,369 (GRCm38) unclassified probably benign
IGL01750:Kmt2d APN 15 98,853,168 (GRCm38) unclassified probably benign
IGL02163:Kmt2d APN 15 98,835,228 (GRCm38) unclassified probably benign
IGL02209:Kmt2d APN 15 98,854,567 (GRCm38) unclassified probably benign
IGL02253:Kmt2d APN 15 98,858,175 (GRCm38) unclassified probably benign
IGL02271:Kmt2d APN 15 98,866,428 (GRCm38) missense possibly damaging 0.89
IGL02291:Kmt2d APN 15 98,865,492 (GRCm38) splice site probably benign
IGL02448:Kmt2d APN 15 98,844,110 (GRCm38) unclassified probably benign
IGL02472:Kmt2d APN 15 98,850,077 (GRCm38) missense probably benign 0.23
IGL02496:Kmt2d APN 15 98,857,558 (GRCm38) unclassified probably benign
IGL02527:Kmt2d APN 15 98,841,747 (GRCm38) unclassified probably benign
IGL02576:Kmt2d APN 15 98,864,120 (GRCm38) missense unknown
IGL02597:Kmt2d APN 15 98,863,831 (GRCm38) missense unknown
IGL02609:Kmt2d APN 15 98,851,793 (GRCm38) unclassified probably benign
IGL03085:Kmt2d APN 15 98,839,940 (GRCm38) unclassified probably benign
IGL03102:Kmt2d APN 15 98,855,543 (GRCm38) missense probably benign
IGL03123:Kmt2d APN 15 98,861,771 (GRCm38) missense unknown
G1citation:Kmt2d UTSW 15 98,849,459 (GRCm38) unclassified probably benign
R0091:Kmt2d UTSW 15 98,844,479 (GRCm38) unclassified probably benign
R0136:Kmt2d UTSW 15 98,854,278 (GRCm38) unclassified probably benign
R0243:Kmt2d UTSW 15 98,850,137 (GRCm38) unclassified probably benign
R0276:Kmt2d UTSW 15 98,850,311 (GRCm38) unclassified probably benign
R0477:Kmt2d UTSW 15 98,853,581 (GRCm38) unclassified probably benign
R0478:Kmt2d UTSW 15 98,853,581 (GRCm38) unclassified probably benign
R0586:Kmt2d UTSW 15 98,835,207 (GRCm38) unclassified probably benign
R0632:Kmt2d UTSW 15 98,853,581 (GRCm38) unclassified probably benign
R0678:Kmt2d UTSW 15 98,850,413 (GRCm38) unclassified probably benign
R0780:Kmt2d UTSW 15 98,862,857 (GRCm38) missense unknown
R0891:Kmt2d UTSW 15 98,852,691 (GRCm38) unclassified probably benign
R1136:Kmt2d UTSW 15 98,857,765 (GRCm38) unclassified probably benign
R1417:Kmt2d UTSW 15 98,866,430 (GRCm38) missense probably damaging 0.99
R1499:Kmt2d UTSW 15 98,844,938 (GRCm38) unclassified probably benign
R1510:Kmt2d UTSW 15 98,856,377 (GRCm38) unclassified probably benign
R1586:Kmt2d UTSW 15 98,865,053 (GRCm38) splice site probably benign
R1640:Kmt2d UTSW 15 98,845,057 (GRCm38) unclassified probably benign
R1714:Kmt2d UTSW 15 98,862,950 (GRCm38) missense unknown
R1725:Kmt2d UTSW 15 98,845,234 (GRCm38) unclassified probably benign
R1728:Kmt2d UTSW 15 98,865,132 (GRCm38) missense probably damaging 1.00
R1729:Kmt2d UTSW 15 98,865,132 (GRCm38) missense probably damaging 1.00
R1741:Kmt2d UTSW 15 98,845,234 (GRCm38) unclassified probably benign
R1744:Kmt2d UTSW 15 98,865,047 (GRCm38) missense probably damaging 0.99
R1746:Kmt2d UTSW 15 98,864,378 (GRCm38) missense probably damaging 0.97
R1753:Kmt2d UTSW 15 98,843,482 (GRCm38) unclassified probably benign
R1782:Kmt2d UTSW 15 98,857,548 (GRCm38) unclassified probably benign
R1789:Kmt2d UTSW 15 98,852,074 (GRCm38) unclassified probably benign
R1802:Kmt2d UTSW 15 98,862,985 (GRCm38) missense unknown
R1808:Kmt2d UTSW 15 98,866,686 (GRCm38) missense probably damaging 1.00
R1822:Kmt2d UTSW 15 98,861,780 (GRCm38) missense unknown
R1831:Kmt2d UTSW 15 98,855,343 (GRCm38) missense probably damaging 0.97
R1920:Kmt2d UTSW 15 98,855,591 (GRCm38) missense probably damaging 1.00
R1920:Kmt2d UTSW 15 98,855,590 (GRCm38) missense probably damaging 0.96
R1956:Kmt2d UTSW 15 98,859,590 (GRCm38) unclassified probably benign
R2100:Kmt2d UTSW 15 98,846,480 (GRCm38) unclassified probably benign
R2120:Kmt2d UTSW 15 98,839,529 (GRCm38) unclassified probably benign
R2188:Kmt2d UTSW 15 98,839,300 (GRCm38) unclassified probably benign
R2191:Kmt2d UTSW 15 98,861,049 (GRCm38) critical splice donor site probably null
R2234:Kmt2d UTSW 15 98,865,248 (GRCm38) missense probably damaging 0.98
R2422:Kmt2d UTSW 15 98,862,266 (GRCm38) missense unknown
R2762:Kmt2d UTSW 15 98,852,055 (GRCm38) unclassified probably benign
R2895:Kmt2d UTSW 15 98,843,939 (GRCm38) unclassified probably benign
R3624:Kmt2d UTSW 15 98,842,902 (GRCm38) unclassified probably benign
R3791:Kmt2d UTSW 15 98,844,149 (GRCm38) unclassified probably benign
R3794:Kmt2d UTSW 15 98,837,359 (GRCm38) unclassified probably benign
R3871:Kmt2d UTSW 15 98,851,021 (GRCm38) unclassified probably benign
R3958:Kmt2d UTSW 15 98,855,549 (GRCm38) missense possibly damaging 0.69
R3983:Kmt2d UTSW 15 98,846,046 (GRCm38) unclassified probably benign
R4211:Kmt2d UTSW 15 98,840,189 (GRCm38) unclassified probably benign
R4212:Kmt2d UTSW 15 98,845,003 (GRCm38) unclassified probably benign
R4240:Kmt2d UTSW 15 98,844,571 (GRCm38) unclassified probably benign
R4246:Kmt2d UTSW 15 98,840,089 (GRCm38) unclassified probably benign
R4361:Kmt2d UTSW 15 98,863,670 (GRCm38) missense unknown
R4388:Kmt2d UTSW 15 98,853,626 (GRCm38) unclassified probably benign
R4602:Kmt2d UTSW 15 98,850,259 (GRCm38) unclassified probably benign
R4606:Kmt2d UTSW 15 98,839,716 (GRCm38) unclassified probably benign
R4658:Kmt2d UTSW 15 98,852,529 (GRCm38) unclassified probably benign
R4840:Kmt2d UTSW 15 98,861,894 (GRCm38) missense unknown
R4895:Kmt2d UTSW 15 98,844,487 (GRCm38) unclassified probably benign
R4906:Kmt2d UTSW 15 98,849,539 (GRCm38) unclassified probably benign
R4976:Kmt2d UTSW 15 98,847,194 (GRCm38) utr 3 prime probably benign
R5093:Kmt2d UTSW 15 98,856,162 (GRCm38) missense probably damaging 1.00
R5119:Kmt2d UTSW 15 98,847,194 (GRCm38) utr 3 prime probably benign
R5160:Kmt2d UTSW 15 98,840,224 (GRCm38) unclassified probably benign
R5260:Kmt2d UTSW 15 98,842,860 (GRCm38) unclassified probably benign
R5274:Kmt2d UTSW 15 98,854,230 (GRCm38) unclassified probably benign
R5450:Kmt2d UTSW 15 98,855,086 (GRCm38) missense probably damaging 1.00
R5461:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5462:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5463:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5465:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5467:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5481:Kmt2d UTSW 15 98,862,005 (GRCm38) missense unknown
R5509:Kmt2d UTSW 15 98,839,676 (GRCm38) unclassified probably benign
R5534:Kmt2d UTSW 15 98,837,357 (GRCm38) unclassified probably benign
R5536:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5537:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5538:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5546:Kmt2d UTSW 15 98,853,068 (GRCm38) unclassified probably benign
R5595:Kmt2d UTSW 15 98,850,024 (GRCm38) unclassified probably benign
R5645:Kmt2d UTSW 15 98,844,397 (GRCm38) unclassified probably benign
R5679:Kmt2d UTSW 15 98,854,272 (GRCm38) unclassified probably benign
R5710:Kmt2d UTSW 15 98,854,106 (GRCm38) unclassified probably benign
R5755:Kmt2d UTSW 15 98,863,646 (GRCm38) missense unknown
R5817:Kmt2d UTSW 15 98,862,363 (GRCm38) missense unknown
R5841:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5842:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5843:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5844:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5845:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R6122:Kmt2d UTSW 15 98,860,692 (GRCm38) unclassified probably benign
R6612:Kmt2d UTSW 15 98,845,858 (GRCm38) unclassified probably benign
R6718:Kmt2d UTSW 15 98,850,539 (GRCm38) unclassified probably benign
R6718:Kmt2d UTSW 15 98,849,586 (GRCm38) unclassified probably benign
R6822:Kmt2d UTSW 15 98,849,459 (GRCm38) unclassified probably benign
R6866:Kmt2d UTSW 15 98,857,393 (GRCm38) unclassified probably benign
R6950:Kmt2d UTSW 15 98,840,020 (GRCm38) unclassified probably benign
R7089:Kmt2d UTSW 15 98,850,272 (GRCm38) missense unknown
R7120:Kmt2d UTSW 15 98,861,065 (GRCm38) missense unknown
R7131:Kmt2d UTSW 15 98,849,616 (GRCm38) unclassified probably benign
R7177:Kmt2d UTSW 15 98,850,386 (GRCm38) missense unknown
R7194:Kmt2d UTSW 15 98,843,833 (GRCm38) missense unknown
R7252:Kmt2d UTSW 15 98,844,266 (GRCm38) missense unknown
R7282:Kmt2d UTSW 15 98,854,104 (GRCm38) missense unknown
R7307:Kmt2d UTSW 15 98,849,418 (GRCm38) missense unknown
R7313:Kmt2d UTSW 15 98,856,623 (GRCm38) missense unknown
R7394:Kmt2d UTSW 15 98,856,384 (GRCm38) missense unknown
R7404:Kmt2d UTSW 15 98,845,495 (GRCm38) missense unknown
R7409:Kmt2d UTSW 15 98,855,354 (GRCm38) missense probably damaging 1.00
R7414:Kmt2d UTSW 15 98,839,856 (GRCm38) missense unknown
R7534:Kmt2d UTSW 15 98,852,018 (GRCm38) missense unknown
R7650:Kmt2d UTSW 15 98,850,870 (GRCm38) missense unknown
R7687:Kmt2d UTSW 15 98,862,120 (GRCm38) missense unknown
R7699:Kmt2d UTSW 15 98,843,719 (GRCm38) missense unknown
R7700:Kmt2d UTSW 15 98,843,719 (GRCm38) missense unknown
R7765:Kmt2d UTSW 15 98,852,334 (GRCm38) missense unknown
R7797:Kmt2d UTSW 15 98,864,406 (GRCm38) missense probably benign 0.24
R7803:Kmt2d UTSW 15 98,862,923 (GRCm38) missense unknown
R7952:Kmt2d UTSW 15 98,850,768 (GRCm38) missense unknown
R8054:Kmt2d UTSW 15 98,843,925 (GRCm38) missense unknown
R8084:Kmt2d UTSW 15 98,842,064 (GRCm38) missense unknown
R8089:Kmt2d UTSW 15 98,842,869 (GRCm38) missense unknown
R8133:Kmt2d UTSW 15 98,864,942 (GRCm38) missense probably damaging 1.00
R8138:Kmt2d UTSW 15 98,843,653 (GRCm38) missense unknown
R8343:Kmt2d UTSW 15 98,852,597 (GRCm38) missense unknown
R8681:Kmt2d UTSW 15 98,846,067 (GRCm38) missense unknown
R8694:Kmt2d UTSW 15 98,844,734 (GRCm38) missense unknown
R8837:Kmt2d UTSW 15 98,864,167 (GRCm38) missense unknown
R8855:Kmt2d UTSW 15 98,856,356 (GRCm38) missense unknown
R8934:Kmt2d UTSW 15 98,861,886 (GRCm38) missense unknown
R9100:Kmt2d UTSW 15 98,849,951 (GRCm38) missense unknown
R9158:Kmt2d UTSW 15 98,843,139 (GRCm38) missense unknown
R9190:Kmt2d UTSW 15 98,852,015 (GRCm38) missense unknown
R9222:Kmt2d UTSW 15 98,849,443 (GRCm38) missense unknown
R9263:Kmt2d UTSW 15 98,849,618 (GRCm38) frame shift probably null
R9336:Kmt2d UTSW 15 98,845,816 (GRCm38) missense unknown
R9397:Kmt2d UTSW 15 98,850,113 (GRCm38) missense unknown
R9415:Kmt2d UTSW 15 98,839,705 (GRCm38) missense unknown
R9482:Kmt2d UTSW 15 98,865,165 (GRCm38) missense probably damaging 1.00
R9529:Kmt2d UTSW 15 98,839,768 (GRCm38) missense unknown
R9610:Kmt2d UTSW 15 98,845,176 (GRCm38) unclassified probably benign
R9611:Kmt2d UTSW 15 98,845,176 (GRCm38) unclassified probably benign
R9611:Kmt2d UTSW 15 98,845,173 (GRCm38) unclassified probably benign
R9612:Kmt2d UTSW 15 98,845,176 (GRCm38) unclassified probably benign
R9613:Kmt2d UTSW 15 98,845,176 (GRCm38) unclassified probably benign
R9644:Kmt2d UTSW 15 98,845,504 (GRCm38) missense unknown
R9716:Kmt2d UTSW 15 98,843,402 (GRCm38) missense unknown
R9763:Kmt2d UTSW 15 98,845,176 (GRCm38) unclassified probably benign
R9782:Kmt2d UTSW 15 98,866,716 (GRCm38) missense probably damaging 1.00
X0018:Kmt2d UTSW 15 98,852,922 (GRCm38) unclassified probably benign
X0024:Kmt2d UTSW 15 98,853,053 (GRCm38) unclassified probably benign
X0062:Kmt2d UTSW 15 98,849,819 (GRCm38) unclassified probably benign
Z1187:Kmt2d UTSW 15 98,851,744 (GRCm38) missense unknown
Z1188:Kmt2d UTSW 15 98,851,744 (GRCm38) missense unknown
Z1189:Kmt2d UTSW 15 98,851,744 (GRCm38) missense unknown
Z1190:Kmt2d UTSW 15 98,851,744 (GRCm38) missense unknown
Z1192:Kmt2d UTSW 15 98,851,744 (GRCm38) missense unknown
Predicted Primers PCR Primer
(F):5'- TAGACACCATAGCCACGGATG -3'
(R):5'- AAAGTGGGGCCCTAACCTTACC -3'

Sequencing Primer
(F):5'- CGCTGCTGAAGGGCATGAG -3'
(R):5'- GGCCCTAACCTTACCCAGTG -3'
Posted On 2019-10-24