Incidental Mutation 'R1856:Anln'
ID206127
Institutional Source Beutler Lab
Gene Symbol Anln
Ensembl Gene ENSMUSG00000036777
Gene Nameanillin, actin binding protein
Synonyms1110037A17Rik, 2900037I21Rik, Scraps
MMRRC Submission 039880-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R1856 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location22332012-22389188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22353331 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 881 (L881Q)
Ref Sequence ENSEMBL: ENSMUSP00000045873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040912] [ENSMUST00000215006]
Predicted Effect probably damaging
Transcript: ENSMUST00000040912
AA Change: L881Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045873
Gene: ENSMUSG00000036777
AA Change: L881Q

DomainStartEndE-ValueType
low complexity region 97 121 N/A INTRINSIC
Pfam:Anillin_N 141 227 5e-34 PFAM
low complexity region 234 250 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
Pfam:Anillin_N 423 501 2.7e-6 PFAM
coiled coil region 566 599 N/A INTRINSIC
coiled coil region 710 729 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
Pfam:Anillin 797 950 8.8e-39 PFAM
PH 981 1106 1.8e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000215006
AA Change: L6Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000216793
AA Change: L54Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217010
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an actin-binding protein that plays a role in cell growth and migration, and in cytokinesis. The encoded protein is thought to regulate actin cytoskeletal dynamics in podocytes, components of the glomerulus. Mutations in this gene are associated with focal segmental glomerulosclerosis 8. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T G 7: 120,278,181 F1017L probably damaging Het
Abcb11 A C 2: 69,245,923 V1147G probably damaging Het
Abcc10 T A 17: 46,306,603 S1128C probably damaging Het
Adam6a G A 12: 113,545,303 C432Y probably damaging Het
Adamdec1 C T 14: 68,570,948 V318M probably damaging Het
Ahnak C A 19: 9,002,048 S232Y possibly damaging Het
Amt A C 9: 108,297,162 H42P probably damaging Het
Anapc1 A T 2: 128,659,788 L778Q probably damaging Het
Ankhd1 G A 18: 36,644,527 A1588T probably benign Het
Appl1 A G 14: 26,927,749 S607P probably damaging Het
Arg2 G T 12: 79,147,662 V87L probably benign Het
Atp13a2 C T 4: 141,004,012 P869L probably benign Het
Atxn7l1 T A 12: 33,358,770 D310E probably damaging Het
Cd6 A T 19: 10,798,602 D164E probably damaging Het
Cdan1 C A 2: 120,724,936 V775L probably benign Het
Cep164 A T 9: 45,775,758 probably null Het
Cep41 A G 6: 30,661,006 S61P probably damaging Het
Clcn7 C A 17: 25,160,471 D764E probably damaging Het
Cog2 G A 8: 124,551,403 G703S possibly damaging Het
Cramp1l T C 17: 24,968,978 D1214G probably damaging Het
Cst7 G T 2: 150,577,708 C98F probably damaging Het
Ctc1 T A 11: 69,034,658 L1007Q probably damaging Het
Cyb5r4 G A 9: 87,022,209 A11T possibly damaging Het
Dcaf8 A G 1: 172,175,553 D306G probably damaging Het
Defb38 T A 8: 19,023,576 K27I probably benign Het
Disp3 T C 4: 148,271,632 E257G probably damaging Het
Dnajc6 T C 4: 101,598,988 S58P probably damaging Het
Dock10 A T 1: 80,606,568 D140E possibly damaging Het
Dopey1 T C 9: 86,492,004 V172A probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eci3 C T 13: 34,953,028 A171T possibly damaging Het
Eml2 A G 7: 19,194,061 D284G probably damaging Het
Eml5 T C 12: 98,810,584 D1377G probably damaging Het
Fam186a T C 15: 99,940,302 E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 L154R probably damaging Het
Gabrb2 A G 11: 42,626,713 N454S probably benign Het
Gm438 T A 4: 144,777,883 M233L probably benign Het
Gpr183 T A 14: 121,954,741 I123L probably benign Het
Gucy1b1 A T 3: 82,058,352 N62K probably benign Het
Hcrtr2 T C 9: 76,259,785 N90S probably damaging Het
Hectd1 A T 12: 51,744,794 L2556Q probably damaging Het
Hfm1 T A 5: 106,847,676 M1290L probably benign Het
Hgsnat A G 8: 25,957,256 W337R probably benign Het
Hmbox1 T C 14: 64,828,648 Y291C probably damaging Het
Hmcn1 T C 1: 150,721,664 N1749S probably benign Het
Igsf10 T C 3: 59,331,272 D496G possibly damaging Het
Iqch C T 9: 63,534,337 probably null Het
Irf6 A G 1: 193,167,535 D255G probably benign Het
Kif9 G A 9: 110,517,719 G642R probably null Het
Klhl20 A G 1: 161,106,742 Y236H probably benign Het
Krt39 T A 11: 99,519,088 K208* probably null Het
Lama3 T A 18: 12,537,781 L808* probably null Het
Lrp5 C T 19: 3,597,346 A1299T probably benign Het
Lysmd4 A G 7: 67,226,231 Q214R probably benign Het
Macf1 T A 4: 123,369,848 E6960V probably damaging Het
Mcpt2 A G 14: 56,043,699 E120G probably benign Het
Mpeg1 A G 19: 12,462,356 T393A probably benign Het
Myh4 G A 11: 67,255,682 E1494K probably damaging Het
Nbas T G 12: 13,474,229 S1695R possibly damaging Het
Nlgn1 G T 3: 25,440,037 Y249* probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nup107 A G 10: 117,750,906 L910P probably damaging Het
Obscn T A 11: 59,040,296 D5838V probably damaging Het
Olfr1218 G A 2: 89,054,859 T189M possibly damaging Het
Olfr347 T C 2: 36,734,345 I8T probably benign Het
Olfr926 T C 9: 38,877,596 I140T possibly damaging Het
Olfr978 T C 9: 39,994,359 I183T probably benign Het
Otogl G T 10: 107,854,264 S915Y possibly damaging Het
P2rx7 T A 5: 122,681,032 C506S probably damaging Het
P4hb T C 11: 120,563,218 E350G probably benign Het
Papolg A T 11: 23,867,379 V606E probably benign Het
Pappa A T 4: 65,340,743 D1576V probably damaging Het
Pclo G T 5: 14,778,552 V1402F probably damaging Het
Pdcd11 A G 19: 47,098,187 T211A probably benign Het
Pdzd2 T C 15: 12,373,855 R2065G possibly damaging Het
Plcl2 T C 17: 50,607,850 V629A probably benign Het
Prkcsh G A 9: 22,004,575 V92I possibly damaging Het
Prpf19 G T 19: 10,902,416 V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 I283F probably damaging Het
Rcc2 T A 4: 140,720,604 D480E probably benign Het
Rnf182 G A 13: 43,668,042 C23Y probably damaging Het
Rnf186 C T 4: 138,967,362 T71I probably benign Het
Scyl3 A G 1: 163,933,696 probably null Het
Slc12a6 G T 2: 112,335,927 probably null Het
Slc1a2 C A 2: 102,777,567 S520Y probably damaging Het
Slc35e2 T A 4: 155,611,729 L191Q probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx33 T C 9: 56,926,011 H258R possibly damaging Het
Tecpr2 A T 12: 110,933,064 H622L probably benign Het
Thbs3 A T 3: 89,226,406 E888D probably damaging Het
Tlk2 T C 11: 105,221,298 L159P probably benign Het
Tmem70 A T 1: 16,677,273 T205S probably damaging Het
Trappc10 T A 10: 78,196,451 H1001L probably benign Het
Trim12a T C 7: 104,300,857 T292A probably benign Het
Trip11 G A 12: 101,883,333 R92* probably null Het
Trpa1 G A 1: 14,899,388 Q386* probably null Het
Trpc4 T A 3: 54,279,989 V454D probably damaging Het
Ttc36 A T 9: 44,802,754 D22E probably benign Het
Ttk A T 9: 83,869,263 I798F probably damaging Het
Ttn T C 2: 76,743,633 I17312V probably damaging Het
Txndc15 A T 13: 55,718,062 E113V possibly damaging Het
Ube2d4 T A 15: 58,846,599 noncoding transcript Het
Urb1 T A 16: 90,761,695 T1723S probably benign Het
Vmn1r65 A T 7: 6,008,266 V323D possibly damaging Het
Vmn2r54 A G 7: 12,632,311 M232T probably benign Het
Wdr59 A G 8: 111,476,181 S577P probably damaging Het
Wfikkn2 C T 11: 94,238,123 W397* probably null Het
Ypel1 T A 16: 17,081,647 probably null Het
Ythdf1 T A 2: 180,910,970 D484V probably damaging Het
Zdhhc17 A G 10: 110,947,293 probably null Het
Zfp472 A T 17: 32,965,913 H2L possibly damaging Het
Zfp953 A T 13: 67,345,358 M74K probably benign Het
Zmat4 C T 8: 23,929,135 T61M probably benign Het
Other mutations in Anln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Anln APN 9 22360824 nonsense probably null
IGL01634:Anln APN 9 22360475 missense probably benign 0.00
IGL02145:Anln APN 9 22338996 splice site probably null
IGL02296:Anln APN 9 22372187 missense possibly damaging 0.67
IGL02352:Anln APN 9 22368412 missense probably benign 0.00
IGL02601:Anln APN 9 22338035 missense probably damaging 0.99
IGL02821:Anln APN 9 22358122 missense possibly damaging 0.55
IGL02863:Anln APN 9 22376365 missense probably damaging 1.00
IGL03274:Anln APN 9 22382269 missense probably damaging 1.00
R0114:Anln UTSW 9 22353346 missense probably damaging 0.99
R0486:Anln UTSW 9 22352826 missense probably benign 0.31
R0712:Anln UTSW 9 22380298 missense probably benign 0.01
R1618:Anln UTSW 9 22350918 critical splice donor site probably null
R1734:Anln UTSW 9 22350955 missense possibly damaging 0.71
R1999:Anln UTSW 9 22333052 makesense probably null
R2073:Anln UTSW 9 22333168 missense probably benign 0.45
R2075:Anln UTSW 9 22333168 missense probably benign 0.45
R2696:Anln UTSW 9 22360963 missense probably benign 0.08
R2943:Anln UTSW 9 22356046 splice site probably null
R4278:Anln UTSW 9 22334000 critical splice donor site probably null
R4548:Anln UTSW 9 22362888 missense possibly damaging 0.80
R4887:Anln UTSW 9 22380188 missense possibly damaging 0.46
R4979:Anln UTSW 9 22376501 missense probably benign
R5087:Anln UTSW 9 22375044 missense possibly damaging 0.61
R5197:Anln UTSW 9 22352781 critical splice donor site probably null
R5353:Anln UTSW 9 22360517 missense probably damaging 1.00
R5748:Anln UTSW 9 22337934 missense probably damaging 0.97
R5863:Anln UTSW 9 22337984 missense probably damaging 0.99
R6146:Anln UTSW 9 22376308 nonsense probably null
R6152:Anln UTSW 9 22360507 missense probably damaging 0.98
R6170:Anln UTSW 9 22368497 missense probably benign 0.01
R6261:Anln UTSW 9 22364046 missense probably damaging 1.00
R6264:Anln UTSW 9 22334117 missense possibly damaging 0.82
R6656:Anln UTSW 9 22351002 missense probably damaging 1.00
R6864:Anln UTSW 9 22382249 missense probably benign 0.36
R7514:Anln UTSW 9 22360857 missense probably damaging 0.96
R7789:Anln UTSW 9 22352037 missense
R7807:Anln UTSW 9 22360880 missense probably damaging 1.00
R7840:Anln UTSW 9 22362723 missense probably benign 0.03
R7912:Anln UTSW 9 22358669 missense possibly damaging 0.53
R8246:Anln UTSW 9 22350955 missense probably benign 0.00
Z1088:Anln UTSW 9 22362801 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTTTTGTACCTGTACAGAAATCC -3'
(R):5'- GTCATCTCTCCAGCCCTAGAG -3'

Sequencing Primer
(F):5'- GAGATCCAGCTGTAAGGCATTTCC -3'
(R):5'- CTCCAGCCCTAGAGATTTTTACAAAG -3'
Posted On2014-06-23