Incidental Mutation 'R1831:Wdr95'
ID207320
Institutional Source Beutler Lab
Gene Symbol Wdr95
Ensembl Gene ENSMUSG00000029658
Gene NameWD40 repeat domain 95
Synonyms4930434E21Rik
MMRRC Submission 039858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1831 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location149528679-149611894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149552426 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 63 (Y63C)
Ref Sequence ENSEMBL: ENSMUSP00000144385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110502] [ENSMUST00000201525] [ENSMUST00000202902]
Predicted Effect probably benign
Transcript: ENSMUST00000110502
SMART Domains Protein: ENSMUSP00000106128
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
Pfam:WD40 4 28 3.3e-3 PFAM
WD40 32 71 4.38e-5 SMART
WD40 120 159 3.27e-4 SMART
WD40 162 203 1.71e-7 SMART
WD40 206 249 3.57e0 SMART
WD40 263 301 1.7e-2 SMART
Blast:WD40 315 363 3e-14 BLAST
Blast:WD40 367 408 4e-13 BLAST
WD40 421 460 2.01e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121108
AA Change: Y63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113092
Gene: ENSMUSG00000029658
AA Change: Y63C

DomainStartEndE-ValueType
Blast:WD40 44 83 9e-11 BLAST
WD40 132 170 1.61e-3 SMART
WD40 174 213 4.38e-5 SMART
WD40 262 301 3.27e-4 SMART
WD40 304 345 1.71e-7 SMART
WD40 348 391 3.57e0 SMART
WD40 405 443 1.7e-2 SMART
Blast:WD40 457 505 3e-14 BLAST
Blast:WD40 509 550 4e-13 BLAST
WD40 563 602 2.01e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130653
AA Change: T51A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201183
Predicted Effect probably benign
Transcript: ENSMUST00000201525
SMART Domains Protein: ENSMUSP00000144234
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
WD40 104 143 2e-6 SMART
WD40 146 187 1.1e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202805
Predicted Effect probably damaging
Transcript: ENSMUST00000202902
AA Change: Y63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144385
Gene: ENSMUSG00000029658
AA Change: Y63C

DomainStartEndE-ValueType
Blast:WD40 44 83 9e-11 BLAST
WD40 132 170 1.61e-3 SMART
WD40 174 213 4.38e-5 SMART
WD40 262 301 3.27e-4 SMART
WD40 304 345 1.71e-7 SMART
WD40 348 391 3.57e0 SMART
WD40 405 443 1.7e-2 SMART
Blast:WD40 457 505 3e-14 BLAST
Blast:WD40 509 550 4e-13 BLAST
WD40 563 602 2.01e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,577,255 D77G probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Capn8 G A 1: 182,611,101 probably null Het
Carmil1 A T 13: 24,164,879 V15E probably benign Het
Ccdc42 T A 11: 68,590,979 M133K probably benign Het
Cd5 T C 19: 10,719,569 D485G probably damaging Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Cep162 T A 9: 87,206,932 I966L probably damaging Het
Cklf T C 8: 104,251,055 F13S probably damaging Het
Csf2rb C T 15: 78,348,253 P587S probably benign Het
Cyp21a1 A T 17: 34,804,035 probably benign Het
Cyp26a1 A T 19: 37,700,623 L335F probably damaging Het
Dcst1 A G 3: 89,352,750 F596L probably damaging Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dnah6 G A 6: 73,181,797 R608C possibly damaging Het
Dnajb5 A T 4: 42,957,333 T311S probably benign Het
Dthd1 A G 5: 62,827,229 T426A probably benign Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Efemp1 A T 11: 28,921,442 D347V possibly damaging Het
Ephb4 T A 5: 137,354,415 Y87N probably damaging Het
Ern1 A T 11: 106,399,842 probably null Het
Fam184a A T 10: 53,647,084 D164E probably damaging Het
Fkbp10 A G 11: 100,423,219 E351G probably damaging Het
Fmn2 A G 1: 174,609,945 S1161G probably benign Het
Frem1 A G 4: 83,020,837 S3P possibly damaging Het
Gm10260 A G 13: 97,760,545 V15A probably benign Het
Gm281 A G 14: 13,899,619 I101T probably damaging Het
Gpr3 C T 4: 133,211,143 A73T possibly damaging Het
Gprc6a T C 10: 51,615,806 T616A probably benign Het
Gtf3c2 G T 5: 31,168,369 Q452K probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hacd2 T C 16: 35,102,064 Y208H probably damaging Het
Hid1 C T 11: 115,348,903 G734R probably damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Itga11 T A 9: 62,782,018 L1155Q probably damaging Het
Kmt2d A G 15: 98,855,343 S157P probably damaging Het
Lamb3 A G 1: 193,334,879 T793A probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ltn1 C T 16: 87,400,146 S1213N possibly damaging Het
Med1 T C 11: 98,156,611 probably benign Het
Megf6 C T 4: 154,270,677 T1483M probably benign Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Ndst3 T A 3: 123,601,478 H501L probably benign Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nmbr C A 10: 14,766,865 T56K probably benign Het
Nxpe2 T A 9: 48,326,152 M268L probably benign Het
Oasl2 A G 5: 114,901,306 Y185C probably benign Het
Ogdhl T A 14: 32,337,527 V377E probably damaging Het
Olfr115 G A 17: 37,609,839 S304L possibly damaging Het
Olfr738 T A 14: 50,414,201 probably null Het
Ovgp1 A G 3: 105,985,068 R346G probably benign Het
Parp14 T A 16: 35,858,588 N337Y possibly damaging Het
Pask A C 1: 93,320,769 probably null Het
Pax3 G T 1: 78,132,340 T227K probably damaging Het
Pik3r6 T A 11: 68,544,034 M594K probably benign Het
Pms1 A G 1: 53,207,211 F390L probably benign Het
Polg G A 7: 79,459,770 T433I probably benign Het
Prex1 T C 2: 166,585,101 Y898C probably damaging Het
Ranbp2 T A 10: 58,479,222 C1921* probably null Het
Rif1 T A 2: 52,078,495 L230* probably null Het
Rnf148 A G 6: 23,654,773 F75L probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sirt1 T C 10: 63,320,646 D735G probably benign Het
Spag5 T A 11: 78,314,256 N622K probably benign Het
Sspo T G 6: 48,489,786 C3935W probably damaging Het
Strbp A G 2: 37,625,265 S250P possibly damaging Het
Tgfbr2 T C 9: 116,090,536 T541A possibly damaging Het
Thada A C 17: 84,231,114 S1489A probably damaging Het
Tiam1 A T 16: 89,860,294 S685T probably benign Het
Tldc1 T C 8: 119,771,253 M171V probably null Het
Tpsb2 T A 17: 25,366,520 probably null Het
Trip4 C A 9: 65,858,340 G359V probably damaging Het
Tsr1 T C 11: 74,900,356 F254L probably benign Het
Vmn1r120 T C 7: 21,053,631 K52E probably benign Het
Vmn1r29 C A 6: 58,307,707 Y137* probably null Het
Vmn2r52 T C 7: 10,159,488 K575E probably damaging Het
Other mutations in Wdr95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Wdr95 APN 5 149595244 critical splice acceptor site probably benign 0.00
IGL02352:Wdr95 APN 5 149580619 missense probably damaging 0.99
IGL02359:Wdr95 APN 5 149580619 missense probably damaging 0.99
IGL02478:Wdr95 APN 5 149596321 missense probably benign 0.02
IGL03078:Wdr95 APN 5 149611597 missense possibly damaging 0.63
IGL03201:Wdr95 APN 5 149581887 splice site probably null
P0037:Wdr95 UTSW 5 149588071 missense probably benign 0.27
R0115:Wdr95 UTSW 5 149564390 missense probably damaging 1.00
R0538:Wdr95 UTSW 5 149580806 missense probably damaging 1.00
R0606:Wdr95 UTSW 5 149588130 missense probably damaging 1.00
R0723:Wdr95 UTSW 5 149574048 missense probably damaging 1.00
R1104:Wdr95 UTSW 5 149606337 missense probably benign 0.00
R1233:Wdr95 UTSW 5 149581858 missense possibly damaging 0.61
R1233:Wdr95 UTSW 5 149595364 missense probably benign 0.00
R1344:Wdr95 UTSW 5 149588098 missense probably damaging 1.00
R1513:Wdr95 UTSW 5 149599294 missense probably benign 0.00
R1623:Wdr95 UTSW 5 149574116 missense probably damaging 1.00
R1633:Wdr95 UTSW 5 149593172 missense probably damaging 0.98
R1664:Wdr95 UTSW 5 149595287 missense probably damaging 0.98
R1686:Wdr95 UTSW 5 149593101 missense probably damaging 1.00
R1741:Wdr95 UTSW 5 149595396 splice site probably null
R1750:Wdr95 UTSW 5 149581886 splice site probably null
R1774:Wdr95 UTSW 5 149564392 nonsense probably null
R1838:Wdr95 UTSW 5 149599366 missense probably benign 0.00
R1907:Wdr95 UTSW 5 149552426 missense probably damaging 1.00
R2019:Wdr95 UTSW 5 149574148 splice site probably benign
R2063:Wdr95 UTSW 5 149579162 splice site probably null
R2392:Wdr95 UTSW 5 149580670 missense probably benign 0.03
R2863:Wdr95 UTSW 5 149581856 nonsense probably null
R4116:Wdr95 UTSW 5 149597575 missense probably benign 0.02
R4237:Wdr95 UTSW 5 149563337 nonsense probably null
R4420:Wdr95 UTSW 5 149532666 missense probably damaging 0.99
R4639:Wdr95 UTSW 5 149581814 splice site probably benign
R4824:Wdr95 UTSW 5 149595332 missense probably damaging 1.00
R4911:Wdr95 UTSW 5 149611692 nonsense probably null
R5016:Wdr95 UTSW 5 149544801 missense probably benign 0.00
R5458:Wdr95 UTSW 5 149564414 missense probably damaging 1.00
R5486:Wdr95 UTSW 5 149596330 nonsense probably null
R5613:Wdr95 UTSW 5 149584470 missense probably damaging 1.00
R5906:Wdr95 UTSW 5 149564227 missense possibly damaging 0.50
R5956:Wdr95 UTSW 5 149594482 missense probably benign 0.00
R6309:Wdr95 UTSW 5 149580803 critical splice acceptor site probably null
R6867:Wdr95 UTSW 5 149580923 splice site probably null
R6964:Wdr95 UTSW 5 149581850 missense probably damaging 1.00
R7008:Wdr95 UTSW 5 149611540 missense probably benign 0.00
R7208:Wdr95 UTSW 5 149595371 missense probably benign 0.02
R7309:Wdr95 UTSW 5 149606293 missense probably benign 0.01
R7504:Wdr95 UTSW 5 149581846 missense probably damaging 0.99
R7660:Wdr95 UTSW 5 149594480 missense possibly damaging 0.86
R7997:Wdr95 UTSW 5 149579157 critical splice donor site probably null
R8084:Wdr95 UTSW 5 149588133 missense probably damaging 1.00
R8356:Wdr95 UTSW 5 149579107 missense probably damaging 1.00
R8456:Wdr95 UTSW 5 149579107 missense probably damaging 1.00
R8523:Wdr95 UTSW 5 149573996 missense probably damaging 1.00
R8682:Wdr95 UTSW 5 149595287 missense possibly damaging 0.94
X0024:Wdr95 UTSW 5 149588167 missense possibly damaging 0.81
Z1176:Wdr95 UTSW 5 149566436 missense probably benign 0.34
Z1177:Wdr95 UTSW 5 149544776 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTTCCAACCCTGTAAATGG -3'
(R):5'- AACTAAGGAGGTCCGTTTTGAG -3'

Sequencing Primer
(F):5'- AACAACTAAGTATTCCACCCCC -3'
(R):5'- TGAGTAGCGTGCTTCTCAGC -3'
Posted On2014-06-23