Incidental Mutation 'R2252:Bckdk'
ID241745
Institutional Source Beutler Lab
Gene Symbol Bckdk
Ensembl Gene ENSMUSG00000030802
Gene Namebranched chain ketoacid dehydrogenase kinase
SynonymsBCKD-kinase
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127904082-127910221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127905418 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 105 (R105S)
Ref Sequence ENSEMBL: ENSMUSP00000146303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071056] [ENSMUST00000124533] [ENSMUST00000151451] [ENSMUST00000206140] [ENSMUST00000206745]
Predicted Effect probably damaging
Transcript: ENSMUST00000071056
AA Change: R105S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070345
Gene: ENSMUSG00000030802
AA Change: R105S

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
Pfam:BCDHK_Adom3 69 222 1.8e-44 PFAM
HATPase_c 264 404 2.06e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124533
AA Change: R105S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146574
Predicted Effect probably damaging
Transcript: ENSMUST00000151451
AA Change: R105S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116990
Gene: ENSMUSG00000030802
AA Change: R105S

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
Pfam:BCDHK_Adom3 68 214 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206068
Predicted Effect probably damaging
Transcript: ENSMUST00000206140
AA Change: R105S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206745
AA Change: R105S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.9536 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-ketoacid dehydrogenase complex (BCKD) is an important regulator of the valine, leucine, and isoleucine catabolic pathways. The protein encoded by this gene is found in the mitochondrion, where it phosphorylates and inactivates BCKD. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Nullizygous mutations lead to altered amino acid metabolism, gait anomalies and neurobehavioral phenotypes. Homozygotes for a gene trapped allele show impaired growth, reduced fertility and epileptic seizures. Homozygotes for another gene trapped allele show motor delay and autism-like behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Bckdk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Bckdk APN 7 127905776 missense possibly damaging 0.67
IGL02176:Bckdk APN 7 127906373 missense probably benign 0.31
IGL02444:Bckdk APN 7 127907446 missense probably damaging 1.00
dottie UTSW 7 127906400 nonsense probably null
Squished UTSW 7 127905418 missense probably damaging 1.00
R2105:Bckdk UTSW 7 127907317 missense probably damaging 1.00
R2240:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R2474:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3696:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3697:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3747:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3749:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3750:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3981:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R4091:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R4303:Bckdk UTSW 7 127905330 intron probably benign
R4367:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4369:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4371:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4841:Bckdk UTSW 7 127905461 splice site probably null
R5615:Bckdk UTSW 7 127907317 missense probably damaging 1.00
R5930:Bckdk UTSW 7 127905973 missense probably damaging 1.00
R7215:Bckdk UTSW 7 127905110 missense possibly damaging 0.82
R7490:Bckdk UTSW 7 127904973 missense unknown
R7596:Bckdk UTSW 7 127906400 nonsense probably null
R7772:Bckdk UTSW 7 127905901 missense probably damaging 1.00
R7973:Bckdk UTSW 7 127906367 missense probably benign 0.21
R8395:Bckdk UTSW 7 127907967 missense probably benign 0.08
R8396:Bckdk UTSW 7 127905759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAAAGTGCGTCTTCCC -3'
(R):5'- CTGATGTTTGAGGCTTAGTCCC -3'

Sequencing Primer
(F):5'- AAAGTGCGTCTTCCCTTTTAGC -3'
(R):5'- TGAGGCTTAGTCCCATCCAGAC -3'
Posted On2014-10-16