Incidental Mutation 'R2253:Acss3'
ID241823
Institutional Source Beutler Lab
Gene Symbol Acss3
Ensembl Gene ENSMUSG00000035948
Gene Nameacyl-CoA synthetase short-chain family member 3
SynonymsLOC380660, 8430416H19Rik
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2253 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location106933517-107123668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107004748 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 384 (A384V)
Ref Sequence ENSEMBL: ENSMUSP00000128209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044668] [ENSMUST00000165067]
Predicted Effect probably damaging
Transcript: ENSMUST00000044668
AA Change: A384V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040823
Gene: ENSMUSG00000035948
AA Change: A384V

DomainStartEndE-ValueType
Pfam:AMP-binding 112 496 4.6e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165067
AA Change: A384V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128209
Gene: ENSMUSG00000035948
AA Change: A384V

DomainStartEndE-ValueType
Pfam:ACAS_N 57 111 8.8e-22 PFAM
Pfam:AMP-binding 113 557 3.2e-81 PFAM
Pfam:AMP-binding_C 565 644 2.2e-22 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Acss3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Acss3 APN 10 106966026 missense probably benign
IGL00941:Acss3 APN 10 107053326 critical splice donor site probably null
IGL00983:Acss3 APN 10 106966964 nonsense probably null
IGL01010:Acss3 APN 10 107023849 splice site probably benign
IGL02227:Acss3 APN 10 107045335 missense probably benign
IGL02296:Acss3 APN 10 107053451 nonsense probably null
IGL02319:Acss3 APN 10 106948750 missense probably damaging 0.99
IGL03181:Acss3 APN 10 107053388 missense probably damaging 1.00
R0032:Acss3 UTSW 10 107123295 missense probably benign 0.13
R0032:Acss3 UTSW 10 107123295 missense probably benign 0.13
R0279:Acss3 UTSW 10 107084871 missense possibly damaging 0.95
R0418:Acss3 UTSW 10 107023912 missense probably damaging 0.99
R0550:Acss3 UTSW 10 107053471 missense probably damaging 1.00
R1114:Acss3 UTSW 10 106988879 missense possibly damaging 0.89
R1491:Acss3 UTSW 10 106937308 missense probably benign
R1625:Acss3 UTSW 10 106937402 critical splice donor site probably null
R1771:Acss3 UTSW 10 106937200 missense probably damaging 1.00
R1956:Acss3 UTSW 10 106936168 missense probably benign 0.00
R2006:Acss3 UTSW 10 106963010 missense possibly damaging 0.81
R2018:Acss3 UTSW 10 106936207 missense probably benign 0.00
R2019:Acss3 UTSW 10 106936207 missense probably benign 0.00
R2078:Acss3 UTSW 10 106967041 missense possibly damaging 0.94
R2391:Acss3 UTSW 10 107123487 missense probably benign 0.00
R3082:Acss3 UTSW 10 107023715 missense possibly damaging 0.94
R3083:Acss3 UTSW 10 107023715 missense possibly damaging 0.94
R4072:Acss3 UTSW 10 107123585 unclassified probably benign
R4086:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4087:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4089:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4090:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4406:Acss3 UTSW 10 107053337 missense probably damaging 1.00
R4607:Acss3 UTSW 10 106967029 missense possibly damaging 0.88
R4608:Acss3 UTSW 10 106967029 missense possibly damaging 0.88
R4790:Acss3 UTSW 10 107023702 nonsense probably null
R4834:Acss3 UTSW 10 107084805 critical splice donor site probably null
R5130:Acss3 UTSW 10 107004725 missense possibly damaging 0.87
R5303:Acss3 UTSW 10 107084851 missense possibly damaging 0.74
R5365:Acss3 UTSW 10 107004728 missense probably damaging 1.00
R5439:Acss3 UTSW 10 106937147 nonsense probably null
R5617:Acss3 UTSW 10 106951990 missense probably damaging 1.00
R5698:Acss3 UTSW 10 106948744 missense probably damaging 1.00
R5726:Acss3 UTSW 10 107123322 missense possibly damaging 0.63
R6154:Acss3 UTSW 10 107123349 missense probably benign 0.02
R6298:Acss3 UTSW 10 107084856 missense probably damaging 1.00
R6592:Acss3 UTSW 10 107023718 missense possibly damaging 0.94
R6707:Acss3 UTSW 10 107084922 missense probably damaging 1.00
R6999:Acss3 UTSW 10 107053501 missense probably damaging 1.00
R7567:Acss3 UTSW 10 107123313 missense probably benign 0.00
R8351:Acss3 UTSW 10 107049404 missense probably damaging 0.98
R8451:Acss3 UTSW 10 107049404 missense probably damaging 0.98
R8515:Acss3 UTSW 10 106948663 missense possibly damaging 0.51
X0027:Acss3 UTSW 10 107123344 missense probably benign 0.05
Z1177:Acss3 UTSW 10 107004777 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGAGTTACACATACAGAGC -3'
(R):5'- GTAGAATCAGGATTTGTTGAGAAGC -3'

Sequencing Primer
(F):5'- TCCTTCTATGGAGGTACTAGACAACC -3'
(R):5'- CAGGATTTGTTGAGAAGCTATCTTTG -3'
Posted On2014-10-16