Incidental Mutation 'R2316:Dzip1'
ID245510
Institutional Source Beutler Lab
Gene Symbol Dzip1
Ensembl Gene ENSMUSG00000042156
Gene NameDAZ interacting protein 1
Synonyms2510025K24Rik, 2810422M04Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R2316 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location118875520-118925460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118901540 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 426 (F426L)
Ref Sequence ENSEMBL: ENSMUSP00000039689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004055] [ENSMUST00000047208]
Predicted Effect probably benign
Transcript: ENSMUST00000004055
AA Change: F426L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000004055
Gene: ENSMUSG00000042156
AA Change: F426L

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.6e-45 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047208
AA Change: F426L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000039689
Gene: ENSMUSG00000042156
AA Change: F426L

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.7e-46 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228540
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a zinc finger protein that has been demonstrated to interact with the deleted in azoospermia (DAZ) protein. DAZ plays an important role early in germ cell development to maintain the initial germ cell population. Deletion of this gene in mice compromises Hedgehog signaling during embryogenesis. Mouse embryos lacking the encoded protein show severe developmental defects with dorsalized neural tubes and underdeveloped somites. Alternative splicing of this gene results in multiple transcript variants. A pseudogene for this gene has been identified on chromosome 5. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted allele lacking exons 2 and 3 exhibit partial embryonic lethality around E9.5, decreased embryo size, underdevelopment of the neural tube and somite and lack of primary cilia on MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,096,070 probably benign Het
Acaca T C 11: 84,264,080 M987T probably benign Het
Acaca A G 11: 84,294,983 T115A possibly damaging Het
Aknad1 A T 3: 108,781,156 D600V probably damaging Het
Arfgef3 T A 10: 18,616,953 T1237S probably benign Het
Brd4 A T 17: 32,212,910 L660Q probably benign Het
C77080 T C 4: 129,223,747 T375A probably damaging Het
Casp1 A G 9: 5,306,213 D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 S951R probably benign Het
Chd9 A G 8: 91,051,128 E2589G probably damaging Het
Dchs1 T C 7: 105,764,204 T1135A possibly damaging Het
Dnhd1 T C 7: 105,674,421 V633A probably damaging Het
Dock6 G T 9: 21,839,677 H400Q probably damaging Het
Elovl4 A G 9: 83,780,773 S236P probably damaging Het
Emp1 T C 6: 135,380,125 F67S probably damaging Het
Garnl3 A G 2: 33,005,152 L635P probably damaging Het
Htr7 C A 19: 35,969,303 probably null Het
Kcnd3 A C 3: 105,669,126 S629R probably benign Het
Lrp2 T A 2: 69,491,847 I1913F possibly damaging Het
Med19 T A 2: 84,686,243 D208E probably benign Het
Mettl21c A T 1: 44,013,632 V75E probably damaging Het
Nsd1 A T 13: 55,233,966 R64S probably damaging Het
Olfr1513 A G 14: 52,349,938 I36T probably benign Het
Olfr469 T A 7: 107,822,800 Y223F probably benign Het
Olfr624 A T 7: 103,670,467 I188N probably damaging Het
Plat T A 8: 22,776,865 M291K probably benign Het
Psmb4 T C 3: 94,885,011 E200G probably benign Het
Reln T C 5: 22,154,956 Y190C probably benign Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Slc5a4a T A 10: 76,178,081 probably null Het
Sobp A T 10: 43,158,038 N97K possibly damaging Het
Stac3 T C 10: 127,503,360 probably null Het
Stat5b G T 11: 100,796,492 T436K probably damaging Het
Tas1r3 A T 4: 155,863,315 M7K probably benign Het
Tmem189 T A 2: 167,654,715 Q46L possibly damaging Het
Vps13b C T 15: 35,674,899 Q1722* probably null Het
Zfp677 A T 17: 21,397,320 Y213F probably benign Het
Other mutations in Dzip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dzip1 APN 14 118883394 missense probably benign 0.41
IGL01534:Dzip1 APN 14 118877239 missense probably damaging 1.00
IGL01617:Dzip1 APN 14 118881065 missense probably benign 0.16
IGL02537:Dzip1 APN 14 118909576 splice site probably benign
IGL02801:Dzip1 APN 14 118885655 nonsense probably null
IGL03354:Dzip1 APN 14 118912569 splice site probably benign
BB003:Dzip1 UTSW 14 118883499 missense probably benign 0.00
BB013:Dzip1 UTSW 14 118883499 missense probably benign 0.00
PIT4151001:Dzip1 UTSW 14 118922788 missense probably damaging 1.00
R0325:Dzip1 UTSW 14 118909557 missense probably damaging 0.99
R0357:Dzip1 UTSW 14 118909538 missense probably damaging 0.99
R0592:Dzip1 UTSW 14 118902139 missense probably damaging 1.00
R0942:Dzip1 UTSW 14 118887197 nonsense probably null
R1110:Dzip1 UTSW 14 118889305 missense probably benign 0.15
R1458:Dzip1 UTSW 14 118922713 missense probably benign 0.16
R1541:Dzip1 UTSW 14 118879478 missense probably damaging 1.00
R2046:Dzip1 UTSW 14 118922478 missense probably damaging 1.00
R2178:Dzip1 UTSW 14 118889404 splice site probably null
R2504:Dzip1 UTSW 14 118881044 missense probably benign 0.11
R2851:Dzip1 UTSW 14 118922445 missense possibly damaging 0.71
R2852:Dzip1 UTSW 14 118922445 missense possibly damaging 0.71
R3149:Dzip1 UTSW 14 118911368 missense probably benign 0.38
R4111:Dzip1 UTSW 14 118877233 nonsense probably null
R4349:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4350:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4351:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4352:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4868:Dzip1 UTSW 14 118877214 missense probably damaging 1.00
R5172:Dzip1 UTSW 14 118887151 missense probably damaging 0.97
R5191:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5192:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5376:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5378:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5655:Dzip1 UTSW 14 118887232 critical splice acceptor site probably null
R5816:Dzip1 UTSW 14 118909480 missense probably benign 0.00
R7256:Dzip1 UTSW 14 118885646 missense probably benign 0.00
R7768:Dzip1 UTSW 14 118879498 missense probably benign 0.11
R7788:Dzip1 UTSW 14 118883393 missense probably benign 0.00
R7926:Dzip1 UTSW 14 118883499 missense probably benign 0.00
X0009:Dzip1 UTSW 14 118877214 missense probably damaging 0.98
X0026:Dzip1 UTSW 14 118922457 missense probably damaging 1.00
Z1177:Dzip1 UTSW 14 118911376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTTTCTGGATTATGGGGAAAAC -3'
(R):5'- TGAAGGTGCCCTGTGATCAC -3'

Sequencing Primer
(F):5'- TTCTGGATTATGGGGAAAACAAAAAC -3'
(R):5'- CTGTGATCACCTGGAGAAGC -3'
Posted On2014-10-30