Incidental Mutation 'R0302:Ankra2'
ID24865
Institutional Source Beutler Lab
Gene Symbol Ankra2
Ensembl Gene ENSMUSG00000021661
Gene Nameankyrin repeat, family A (RFXANK-like), 2
Synonyms
MMRRC Submission 038514-MU
Accession Numbers

Ncbi RefSeq: NM_001271388.1, NM_001271389.1, NM_001271390.1, NM_023472.2, NM_001271391.1, NM_001271392.1; MGI: 1915808

Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location98263074-98274754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98271692 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 216 (S216R)
Ref Sequence ENSEMBL: ENSMUSP00000117508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022164] [ENSMUST00000091356] [ENSMUST00000123924] [ENSMUST00000150352] [ENSMUST00000150916] [ENSMUST00000226100]
Predicted Effect probably damaging
Transcript: ENSMUST00000022164
AA Change: S216R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022164
Gene: ENSMUSG00000021661
AA Change: S216R

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Blast:ANK 279 308 1e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000091356
AA Change: S56R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088915
Gene: ENSMUSG00000021661
AA Change: S56R

DomainStartEndE-ValueType
ANK 20 49 1.45e-6 SMART
ANK 53 82 1.05e-3 SMART
ANK 86 115 1.76e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123924
AA Change: S216R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122701
Gene: ENSMUSG00000021661
AA Change: S216R

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150352
AA Change: S216R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117508
Gene: ENSMUSG00000021661
AA Change: S216R

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150916
AA Change: S56R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116590
Gene: ENSMUSG00000021661
AA Change: S56R

DomainStartEndE-ValueType
ANK 20 49 1.45e-6 SMART
ANK 53 82 1.05e-3 SMART
ANK 86 115 1.76e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223606
Predicted Effect probably damaging
Transcript: ENSMUST00000226100
AA Change: S56R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.4594 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Ankra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Ankra2 APN 13 98273374 splice site probably benign
IGL02807:Ankra2 APN 13 98271742 missense probably damaging 1.00
IGL03030:Ankra2 APN 13 98273373 splice site probably benign
R0068:Ankra2 UTSW 13 98273383 nonsense probably null
R0068:Ankra2 UTSW 13 98273383 nonsense probably null
R0499:Ankra2 UTSW 13 98266454 missense probably damaging 1.00
R0729:Ankra2 UTSW 13 98271727 missense probably damaging 1.00
R1848:Ankra2 UTSW 13 98271124 missense probably damaging 1.00
R2185:Ankra2 UTSW 13 98266404 missense probably damaging 0.99
R2230:Ankra2 UTSW 13 98271138 missense probably damaging 0.99
R2232:Ankra2 UTSW 13 98271138 missense probably damaging 0.99
R3898:Ankra2 UTSW 13 98273809 missense probably benign 0.13
R4605:Ankra2 UTSW 13 98266234 intron probably benign
R4855:Ankra2 UTSW 13 98273411 missense probably damaging 1.00
R5806:Ankra2 UTSW 13 98268497 critical splice donor site probably null
R5901:Ankra2 UTSW 13 98271136 missense probably damaging 0.99
R6478:Ankra2 UTSW 13 98268442 missense probably damaging 1.00
R7469:Ankra2 UTSW 13 98266374 missense probably benign 0.01
Z1177:Ankra2 UTSW 13 98272277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GCATCCATTGTGCTTGTGTTACGTC -3'
(R):5'- TCAATCAAATGCTGCTACGGACCTG -3'

Sequencing Primer
(F):5'- TCCTTAGTAACCCTAGAGCGTGG -3'
(R):5'- GTGAGCTGGACCGTCATTC -3'
Protein Function and Prediction

Ankra2 encodes the 313-amino acid ankyrin-repeat protein 2 (ANKRA2) that has four C-terminal ankyrin repeats (1). ANKRA2 has been proposed to facilitate endocytosis of vitamin carriers and lipoproteins in the proximal tubules of the kidney through an interaction with the endocytic receptor, megalin (2).  ANKRA2 has also been shown to be a binding partner for the α-subunit of rat large-conductance Ca2+-activated K+ channel (rSlo) at the plasma membrane (3). An association with rSlo indicates that ANKRA2 could alter the excitability of neurons by binding directly to endogenous BKCa+ channels and altering its gating kinetics (3). Yeast two-hybrid screens have identified ANKRA2 as a binding partner of histone deaceytlase 4 (HDAC4) (4) that acts as a repressor (along with HDAC4 and HDAC5) of the Aryl hydrocarbon receptor transcription factor in xenobiotic signaling pathways (5). Ankra2 generates several transcripts. Northern blot analysis determined that a 2.0-kb Ankra2 transcript is ubiquitously expressed, while a 2.7-kb transcript is expressed in the brain, spleen, lung, liver, and kidney; a 2.5-kb transcript is expressed in the testis (2). Another study in rat tissues determined by RT-PCR that rat transcripts were expressed in all tissues, with higher levels in brain subregions and testis (3). Western blot analysis determined that ANKRA2 is enriched in apical membranes of the proximal tubule (2). Immunohistochemistry determined that cytoplasmic ANKRA2 is localized along the plasma membrane (2).

References
Posted On2013-04-16
Science WriterAnne Murray