Incidental Mutation 'R2656:Ggt1'
ID252774
Institutional Source Beutler Lab
Gene Symbol Ggt1
Ensembl Gene ENSMUSG00000006345
Gene Namegamma-glutamyltransferase 1
SynonymsGgtp, CD224, GGT, dwg
MMRRC Submission 040431-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2656 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75561604-75586200 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 75581385 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 5 (Y5*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006508] [ENSMUST00000124259] [ENSMUST00000129232] [ENSMUST00000134503] [ENSMUST00000139459] [ENSMUST00000143226] [ENSMUST00000143792] [ENSMUST00000145928]
Predicted Effect probably null
Transcript: ENSMUST00000006508
AA Change: Y323*
SMART Domains Protein: ENSMUSP00000006508
Gene: ENSMUSG00000006345
AA Change: Y323*

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 563 4.9e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124259
SMART Domains Protein: ENSMUSP00000122616
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 235 1.6e-70 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129020
AA Change: Y218*
SMART Domains Protein: ENSMUSP00000118825
Gene: ENSMUSG00000006345
AA Change: Y218*

DomainStartEndE-ValueType
Pfam:G_glu_transpept 1 263 3.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129232
SMART Domains Protein: ENSMUSP00000115118
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 189 9e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134503
AA Change: Y323*
SMART Domains Protein: ENSMUSP00000121312
Gene: ENSMUSG00000006345
AA Change: Y323*

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 563 1.4e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139459
SMART Domains Protein: ENSMUSP00000121774
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 243 1.7e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143226
SMART Domains Protein: ENSMUSP00000115115
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 190 5.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143792
SMART Domains Protein: ENSMUSP00000117851
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 237 2.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145928
SMART Domains Protein: ENSMUSP00000118852
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 210 6.5e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148447
Predicted Effect probably null
Transcript: ENSMUST00000155186
AA Change: Y5*
SMART Domains Protein: ENSMUSP00000123017
Gene: ENSMUSG00000006345
AA Change: Y5*

DomainStartEndE-ValueType
Pfam:G_glu_transpept 1 128 6.3e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156487
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes gamma-glutamyl transpeptidase, a plasmamembrane-associated enzyme that cleaves the peptide bond between gamma-glutamyl and cysteinyl glycine moieties of glutathione. The encoded protein is autocatalytically processed to generate an enzymatically active heterodimer comprised of heavy and light chains. Mice lacking the encoded protein grow slowly, develop cataracts and have elevated levels of glutathione in plasma and urine. Transgenic overexpression of the encoded protein in mice enhances osteoclastic bone resorption. The mutant alleles termed 'Dwarf grey' and 'Dwarf grey Bayer' in mice are associated with deletions in this gene. A gamma-glutamyl transpeptidase paralog is located adjacent to this gene. Alternative splicing results in multiple transcript variants. Additional transcripts using alternate promoters and differing in 5' UTRs have been described. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutants may exhibit impaired growth, skeletal abnormalities, cataracts, lethargic behavior, premature greying, sterility, and shortened life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,696 C655R probably damaging Het
Adgrf3 A T 5: 30,196,438 V864D possibly damaging Het
Angptl3 A G 4: 99,037,964 I444V probably benign Het
Atp8b2 C T 3: 89,941,758 A1090T probably benign Het
BC005561 A G 5: 104,519,315 I568V probably benign Het
Bcl2l2 C T 14: 54,885,432 R47C probably benign Het
Ces2a G A 8: 104,736,134 M118I probably benign Het
Cyp4a29 T G 4: 115,249,724 L193V possibly damaging Het
Dpp8 A G 9: 65,080,804 Y877C probably damaging Het
Enpp6 C T 8: 47,082,418 R33* probably null Het
Fsip2 G A 2: 82,979,045 D1903N possibly damaging Het
Gm14412 A T 2: 177,315,200 C301S unknown Het
Gpatch2l T A 12: 86,288,810 D428E probably damaging Het
Grin2b C T 6: 135,733,429 G1040S probably damaging Het
Has2 T C 15: 56,681,828 D126G possibly damaging Het
Itgam T G 7: 128,116,815 L1120R probably null Het
Kank4 T C 4: 98,778,957 N418D probably damaging Het
Kcnk3 T C 5: 30,622,671 V355A possibly damaging Het
Lonrf2 C T 1: 38,815,960 probably null Het
Lrp1b A T 2: 41,511,581 C240S probably damaging Het
Mapk8ip3 T G 17: 24,912,807 E386A probably damaging Het
Mtmr14 A G 6: 113,240,366 I80V probably benign Het
Nav2 A C 7: 49,545,942 D961A probably damaging Het
Nmt2 A G 2: 3,307,013 D107G probably benign Het
Nsd1 A G 13: 55,246,868 K761E probably damaging Het
Ogdh A G 11: 6,348,678 T641A probably benign Het
Ogdhl T G 14: 32,332,826 F244V possibly damaging Het
Olfr1447 A G 19: 12,901,666 I38T probably benign Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr639 G A 7: 104,011,865 S279L probably damaging Het
Olfr699 T A 7: 106,790,513 T163S probably damaging Het
Pfpl T C 19: 12,430,236 I617T probably benign Het
Ppfia2 T G 10: 106,865,407 probably null Het
Prickle1 T C 15: 93,503,370 E411G probably benign Het
Prpsap2 C A 11: 61,730,225 M343I probably benign Het
Prpsap2 A G 11: 61,752,891 V72A probably benign Het
Ranbp17 A T 11: 33,243,122 D977E probably benign Het
Rin1 T C 19: 5,052,176 S238P probably damaging Het
Scap C T 9: 110,374,019 R254W probably damaging Het
Scn3a T C 2: 65,526,518 D194G probably damaging Het
Shisa7 T C 7: 4,829,819 H481R possibly damaging Het
Slc6a6 T C 6: 91,741,048 Y323H probably damaging Het
Tlr9 T C 9: 106,223,941 S144P probably benign Het
Tmem69 T A 4: 116,553,590 K61M probably damaging Het
Ttc21a A G 9: 119,941,265 D134G probably damaging Het
Ttn A G 2: 76,894,270 probably benign Het
Vwf A G 6: 125,555,361 T26A probably benign Het
Zbtb16 A T 9: 48,832,688 I108N probably damaging Het
Zc3h7b T A 15: 81,780,430 Y497N probably damaging Het
Zfp652 A G 11: 95,749,329 S27G probably damaging Het
Zfp808 A G 13: 62,172,852 T632A possibly damaging Het
Znhit6 T C 3: 145,578,169 probably null Het
Other mutations in Ggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Ggt1 APN 10 75584863 missense probably benign 0.15
IGL01593:Ggt1 APN 10 75585287 critical splice donor site probably null
IGL02713:Ggt1 APN 10 75574344 missense probably damaging 1.00
IGL03276:Ggt1 APN 10 75580497 unclassified probably benign
PIT4498001:Ggt1 UTSW 10 75578855 missense possibly damaging 0.95
R0373:Ggt1 UTSW 10 75579270 missense probably benign 0.11
R0420:Ggt1 UTSW 10 75576213 splice site probably benign
R0505:Ggt1 UTSW 10 75585957 missense probably damaging 0.99
R0630:Ggt1 UTSW 10 75585502 splice site probably null
R1837:Ggt1 UTSW 10 75579294 missense probably benign 0.00
R2655:Ggt1 UTSW 10 75581385 nonsense probably null
R2910:Ggt1 UTSW 10 75580596 missense probably benign 0.09
R3840:Ggt1 UTSW 10 75581385 nonsense probably null
R3841:Ggt1 UTSW 10 75581385 nonsense probably null
R4744:Ggt1 UTSW 10 75585899 missense probably benign 0.00
R5254:Ggt1 UTSW 10 75579198 unclassified probably null
R5323:Ggt1 UTSW 10 75585661 critical splice acceptor site probably null
R5326:Ggt1 UTSW 10 75585706 critical splice donor site probably null
R5512:Ggt1 UTSW 10 75584884 missense probably damaging 0.99
R5579:Ggt1 UTSW 10 75585948 missense probably damaging 1.00
R5707:Ggt1 UTSW 10 75585238 missense probably benign 0.01
R5961:Ggt1 UTSW 10 75585902 unclassified probably null
R6159:Ggt1 UTSW 10 75584965 missense probably damaging 1.00
R6239:Ggt1 UTSW 10 75585681 unclassified probably null
R7224:Ggt1 UTSW 10 75574276 missense possibly damaging 0.86
R7570:Ggt1 UTSW 10 75585594 missense probably damaging 1.00
R7649:Ggt1 UTSW 10 75585456 missense possibly damaging 0.89
R7702:Ggt1 UTSW 10 75576282 missense probably benign 0.00
R7713:Ggt1 UTSW 10 75585674 missense probably damaging 1.00
R7823:Ggt1 UTSW 10 75574341 missense possibly damaging 0.88
R8070:Ggt1 UTSW 10 75578899 missense not run
Predicted Primers PCR Primer
(F):5'- CTTGCATGGCCATTGCTGTAG -3'
(R):5'- AACATGGTAACGAGTCTGCC -3'

Sequencing Primer
(F):5'- CCTATTTCCTTTCCTATGGTAGAGGG -3'
(R):5'- TGGTAACGAGTCTGCCCTGAAATC -3'
Posted On2014-12-04