Mutagenetix > Incidental Mutations

Incidental Mutation 'R2656:Grin2b'

252746

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

040431-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2656 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 135733429 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 1040 (G1040S)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

Predicted Effect

probably damaging
Transcript: ENSMUST00000053880
AA Change: G1040S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: G1040S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111905
AA Change: G1040S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: G1040S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136027

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	A	G	5: 8,117,696	C655R	probably damaging	Het
Adgrf3	A	T	5: 30,196,438	V864D	possibly damaging	Het
Angptl3	A	G	4: 99,037,964	I444V	probably benign	Het
Atp8b2	C	T	3: 89,941,758	A1090T	probably benign	Het
BC005561	A	G	5: 104,519,315	I568V	probably benign	Het
Bcl2l2	C	T	14: 54,885,432	R47C	probably benign	Het
Ces2a	G	A	8: 104,736,134	M118I	probably benign	Het
Cyp4a29	T	G	4: 115,249,724	L193V	possibly damaging	Het
Dpp8	A	G	9: 65,080,804	Y877C	probably damaging	Het
Enpp6	C	T	8: 47,082,418	R33*	probably null	Het
Fsip2	G	A	2: 82,979,045	D1903N	possibly damaging	Het
Ggt1	T	A	10: 75,581,385	Y5*	probably null	Het
Gm14412	A	T	2: 177,315,200	C301S	unknown	Het
Gpatch2l	T	A	12: 86,288,810	D428E	probably damaging	Het
Has2	T	C	15: 56,681,828	D126G	possibly damaging	Het
Itgam	T	G	7: 128,116,815	L1120R	probably null	Het
Kank4	T	C	4: 98,778,957	N418D	probably damaging	Het
Kcnk3	T	C	5: 30,622,671	V355A	possibly damaging	Het
Lonrf2	C	T	1: 38,815,960		probably null	Het
Lrp1b	A	T	2: 41,511,581	C240S	probably damaging	Het
Mapk8ip3	T	G	17: 24,912,807	E386A	probably damaging	Het
Mtmr14	A	G	6: 113,240,366	I80V	probably benign	Het
Nav2	A	C	7: 49,545,942	D961A	probably damaging	Het
Nmt2	A	G	2: 3,307,013	D107G	probably benign	Het
Nsd1	A	G	13: 55,246,868	K761E	probably damaging	Het
Ogdh	A	G	11: 6,348,678	T641A	probably benign	Het
Ogdhl	T	G	14: 32,332,826	F244V	possibly damaging	Het
Olfr1447	A	G	19: 12,901,666	I38T	probably benign	Het
Olfr1454	A	T	19: 13,063,984	H191L	probably benign	Het
Olfr639	G	A	7: 104,011,865	S279L	probably damaging	Het
Olfr699	T	A	7: 106,790,513	T163S	probably damaging	Het
Pfpl	T	C	19: 12,430,236	I617T	probably benign	Het
Ppfia2	T	G	10: 106,865,407		probably null	Het
Prickle1	T	C	15: 93,503,370	E411G	probably benign	Het
Prpsap2	C	A	11: 61,730,225	M343I	probably benign	Het
Prpsap2	A	G	11: 61,752,891	V72A	probably benign	Het
Ranbp17	A	T	11: 33,243,122	D977E	probably benign	Het
Rin1	T	C	19: 5,052,176	S238P	probably damaging	Het
Scap	C	T	9: 110,374,019	R254W	probably damaging	Het
Scn3a	T	C	2: 65,526,518	D194G	probably damaging	Het
Shisa7	T	C	7: 4,829,819	H481R	possibly damaging	Het
Slc6a6	T	C	6: 91,741,048	Y323H	probably damaging	Het
Tlr9	T	C	9: 106,223,941	S144P	probably benign	Het
Tmem69	T	A	4: 116,553,590	K61M	probably damaging	Het
Ttc21a	A	G	9: 119,941,265	D134G	probably damaging	Het
Ttn	A	G	2: 76,894,270		probably benign	Het
Vwf	A	G	6: 125,555,361	T26A	probably benign	Het
Zbtb16	A	T	9: 48,832,688	I108N	probably damaging	Het
Zc3h7b	T	A	15: 81,780,430	Y497N	probably damaging	Het
Zfp652	A	G	11: 95,749,329	S27G	probably damaging	Het
Zfp808	A	G	13: 62,172,852	T632A	possibly damaging	Het
Znhit6	T	C	3: 145,578,169		probably null	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCAGCTCGATTTCATCAAACTC -3'
(R):5'- CTGAAGGACAGCAATGTGTACC -3'

Sequencing Primer
(F):5'- CTCCTAGATTTGGCCGAGG -3'
(R):5'- GGACAGCAATGTGTACCAAGACC -3'

Posted On

2014-12-04