Incidental Mutation 'R2656:Zfp652'
ID252786
Institutional Source Beutler Lab
Gene Symbol Zfp652
Ensembl Gene ENSMUSG00000075595
Gene Namezinc finger protein 652
Synonyms9530033F24Rik
MMRRC Submission 040431-MU
Accession Numbers

Ncbi RefSeq: NM_201609.2; MGI:2442221

Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R2656 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location95712673-95835115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95749329 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 27 (S27G)
Ref Sequence ENSEMBL: ENSMUSP00000103345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091565] [ENSMUST00000107717] [ENSMUST00000133070] [ENSMUST00000148945]
Predicted Effect probably damaging
Transcript: ENSMUST00000091565
AA Change: S27G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000089153
Gene: ENSMUSG00000075595
AA Change: S27G

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
ZnF_C2H2 440 462 1.15e-5 SMART
ZnF_C2H2 468 488 6.15e1 SMART
low complexity region 508 529 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107717
AA Change: S27G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103345
Gene: ENSMUSG00000075595
AA Change: S27G

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
ZnF_C2H2 440 462 1.15e-5 SMART
ZnF_C2H2 468 488 6.15e1 SMART
low complexity region 508 529 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133070
AA Change: S27G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122280
Gene: ENSMUSG00000075595
AA Change: S27G

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148945
AA Change: S27G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115393
Gene: ENSMUSG00000075595
AA Change: S27G

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
ZnF_C2H2 118 141 4.34e-1 SMART
ZnF_C2H2 148 170 2.53e-2 SMART
ZnF_C2H2 176 198 6.78e-3 SMART
ZnF_C2H2 204 226 2.95e-3 SMART
ZnF_C2H2 232 254 1.95e-3 SMART
ZnF_C2H2 260 282 1.15e-5 SMART
ZnF_C2H2 288 308 6.15e1 SMART
low complexity region 328 349 N/A INTRINSIC
low complexity region 364 396 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI

All alleles(23) : Targeted(1) Gene trapped(22)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,696 C655R probably damaging Het
Adgrf3 A T 5: 30,196,438 V864D possibly damaging Het
Angptl3 A G 4: 99,037,964 I444V probably benign Het
Atp8b2 C T 3: 89,941,758 A1090T probably benign Het
BC005561 A G 5: 104,519,315 I568V probably benign Het
Bcl2l2 C T 14: 54,885,432 R47C probably benign Het
Ces2a G A 8: 104,736,134 M118I probably benign Het
Cyp4a29 T G 4: 115,249,724 L193V possibly damaging Het
Dpp8 A G 9: 65,080,804 Y877C probably damaging Het
Enpp6 C T 8: 47,082,418 R33* probably null Het
Fsip2 G A 2: 82,979,045 D1903N possibly damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Gm14412 A T 2: 177,315,200 C301S unknown Het
Gpatch2l T A 12: 86,288,810 D428E probably damaging Het
Grin2b C T 6: 135,733,429 G1040S probably damaging Het
Has2 T C 15: 56,681,828 D126G possibly damaging Het
Itgam T G 7: 128,116,815 L1120R probably null Het
Kank4 T C 4: 98,778,957 N418D probably damaging Het
Kcnk3 T C 5: 30,622,671 V355A possibly damaging Het
Lonrf2 C T 1: 38,815,960 probably null Het
Lrp1b A T 2: 41,511,581 C240S probably damaging Het
Mapk8ip3 T G 17: 24,912,807 E386A probably damaging Het
Mtmr14 A G 6: 113,240,366 I80V probably benign Het
Nav2 A C 7: 49,545,942 D961A probably damaging Het
Nmt2 A G 2: 3,307,013 D107G probably benign Het
Nsd1 A G 13: 55,246,868 K761E probably damaging Het
Ogdh A G 11: 6,348,678 T641A probably benign Het
Ogdhl T G 14: 32,332,826 F244V possibly damaging Het
Olfr1447 A G 19: 12,901,666 I38T probably benign Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr639 G A 7: 104,011,865 S279L probably damaging Het
Olfr699 T A 7: 106,790,513 T163S probably damaging Het
Pfpl T C 19: 12,430,236 I617T probably benign Het
Ppfia2 T G 10: 106,865,407 probably null Het
Prickle1 T C 15: 93,503,370 E411G probably benign Het
Prpsap2 C A 11: 61,730,225 M343I probably benign Het
Prpsap2 A G 11: 61,752,891 V72A probably benign Het
Ranbp17 A T 11: 33,243,122 D977E probably benign Het
Rin1 T C 19: 5,052,176 S238P probably damaging Het
Scap C T 9: 110,374,019 R254W probably damaging Het
Scn3a T C 2: 65,526,518 D194G probably damaging Het
Shisa7 T C 7: 4,829,819 H481R possibly damaging Het
Slc6a6 T C 6: 91,741,048 Y323H probably damaging Het
Tlr9 T C 9: 106,223,941 S144P probably benign Het
Tmem69 T A 4: 116,553,590 K61M probably damaging Het
Ttc21a A G 9: 119,941,265 D134G probably damaging Het
Ttn A G 2: 76,894,270 probably benign Het
Vwf A G 6: 125,555,361 T26A probably benign Het
Zbtb16 A T 9: 48,832,688 I108N probably damaging Het
Zc3h7b T A 15: 81,780,430 Y497N probably damaging Het
Zfp808 A G 13: 62,172,852 T632A possibly damaging Het
Znhit6 T C 3: 145,578,169 probably null Het
Other mutations in Zfp652
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0023:Zfp652 UTSW 11 95753469 nonsense probably null
R0023:Zfp652 UTSW 11 95753469 nonsense probably null
R0432:Zfp652 UTSW 11 95763739 missense possibly damaging 0.50
R0464:Zfp652 UTSW 11 95763649 missense probably damaging 0.99
R1146:Zfp652 UTSW 11 95749782 missense possibly damaging 0.86
R1146:Zfp652 UTSW 11 95749782 missense possibly damaging 0.86
R1920:Zfp652 UTSW 11 95764025 missense possibly damaging 0.73
R1922:Zfp652 UTSW 11 95764025 missense possibly damaging 0.73
R2090:Zfp652 UTSW 11 95754008 missense probably benign 0.14
R2290:Zfp652 UTSW 11 95750023 missense possibly damaging 0.58
R4790:Zfp652 UTSW 11 95749609 missense probably damaging 0.99
R5073:Zfp652 UTSW 11 95750064 missense possibly damaging 0.65
R5098:Zfp652 UTSW 11 95752936 missense probably damaging 1.00
R5209:Zfp652 UTSW 11 95763665 missense possibly damaging 0.66
R5569:Zfp652 UTSW 11 95749290 missense probably benign
R5905:Zfp652 UTSW 11 95749863 missense probably benign
R6026:Zfp652 UTSW 11 95749962 missense possibly damaging 0.95
R6054:Zfp652 UTSW 11 95749863 missense probably benign
R6629:Zfp652 UTSW 11 95763790 missense probably damaging 0.96
R6815:Zfp652 UTSW 11 95749404 nonsense probably null
R6932:Zfp652 UTSW 11 95763841 missense probably benign
R7384:Zfp652 UTSW 11 95753004 missense probably damaging 1.00
R7644:Zfp652 UTSW 11 95750088 missense probably damaging 1.00
R7667:Zfp652 UTSW 11 95749718 missense probably benign 0.00
R7881:Zfp652 UTSW 11 95750109 missense possibly damaging 0.83
R7964:Zfp652 UTSW 11 95750109 missense possibly damaging 0.83
R8045:Zfp652 UTSW 11 95749657 missense possibly damaging 0.94
Z1177:Zfp652 UTSW 11 95749935 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTGTGACACAGGAAGAACTG -3'
(R):5'- GCTCCCTGAAATATGGCTGC -3'

Sequencing Primer
(F):5'- CAGGCTGCAGGAGTTTCTTATTCTC -3'
(R):5'- GAAATATGGCTGCTCCTCCG -3'
Posted On2014-12-04