Incidental Mutation 'R2656:Has2'
ID252797
Institutional Source Beutler Lab
Gene Symbol Has2
Ensembl Gene ENSMUSG00000022367
Gene Namehyaluronan synthase 2
Synonyms
MMRRC Submission 040431-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2656 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location56665627-56694539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56681828 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 126 (D126G)
Ref Sequence ENSEMBL: ENSMUSP00000062212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050544
AA Change: D126G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062212
Gene: ENSMUSG00000022367
AA Change: D126G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Pfam:Glycos_transf_2 86 156 1.7e-7 PFAM
Pfam:Glyco_tranf_2_3 159 357 1.2e-17 PFAM
Pfam:Chitin_synth_2 193 464 1.9e-17 PFAM
Pfam:Glyco_trans_2_3 207 534 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation die during midgestation with severe defects in yolk sac and systemic vasculature, including pericardial edema, compaction of the extracellular space, and absence of endocardial cushions and trabeculae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,696 C655R probably damaging Het
Adgrf3 A T 5: 30,196,438 V864D possibly damaging Het
Angptl3 A G 4: 99,037,964 I444V probably benign Het
Atp8b2 C T 3: 89,941,758 A1090T probably benign Het
BC005561 A G 5: 104,519,315 I568V probably benign Het
Bcl2l2 C T 14: 54,885,432 R47C probably benign Het
Ces2a G A 8: 104,736,134 M118I probably benign Het
Cyp4a29 T G 4: 115,249,724 L193V possibly damaging Het
Dpp8 A G 9: 65,080,804 Y877C probably damaging Het
Enpp6 C T 8: 47,082,418 R33* probably null Het
Fsip2 G A 2: 82,979,045 D1903N possibly damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Gm14412 A T 2: 177,315,200 C301S unknown Het
Gpatch2l T A 12: 86,288,810 D428E probably damaging Het
Grin2b C T 6: 135,733,429 G1040S probably damaging Het
Itgam T G 7: 128,116,815 L1120R probably null Het
Kank4 T C 4: 98,778,957 N418D probably damaging Het
Kcnk3 T C 5: 30,622,671 V355A possibly damaging Het
Lonrf2 C T 1: 38,815,960 probably null Het
Lrp1b A T 2: 41,511,581 C240S probably damaging Het
Mapk8ip3 T G 17: 24,912,807 E386A probably damaging Het
Mtmr14 A G 6: 113,240,366 I80V probably benign Het
Nav2 A C 7: 49,545,942 D961A probably damaging Het
Nmt2 A G 2: 3,307,013 D107G probably benign Het
Nsd1 A G 13: 55,246,868 K761E probably damaging Het
Ogdh A G 11: 6,348,678 T641A probably benign Het
Ogdhl T G 14: 32,332,826 F244V possibly damaging Het
Olfr1447 A G 19: 12,901,666 I38T probably benign Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr639 G A 7: 104,011,865 S279L probably damaging Het
Olfr699 T A 7: 106,790,513 T163S probably damaging Het
Pfpl T C 19: 12,430,236 I617T probably benign Het
Ppfia2 T G 10: 106,865,407 probably null Het
Prickle1 T C 15: 93,503,370 E411G probably benign Het
Prpsap2 C A 11: 61,730,225 M343I probably benign Het
Prpsap2 A G 11: 61,752,891 V72A probably benign Het
Ranbp17 A T 11: 33,243,122 D977E probably benign Het
Rin1 T C 19: 5,052,176 S238P probably damaging Het
Scap C T 9: 110,374,019 R254W probably damaging Het
Scn3a T C 2: 65,526,518 D194G probably damaging Het
Shisa7 T C 7: 4,829,819 H481R possibly damaging Het
Slc6a6 T C 6: 91,741,048 Y323H probably damaging Het
Tlr9 T C 9: 106,223,941 S144P probably benign Het
Tmem69 T A 4: 116,553,590 K61M probably damaging Het
Ttc21a A G 9: 119,941,265 D134G probably damaging Het
Ttn A G 2: 76,894,270 probably benign Het
Vwf A G 6: 125,555,361 T26A probably benign Het
Zbtb16 A T 9: 48,832,688 I108N probably damaging Het
Zc3h7b T A 15: 81,780,430 Y497N probably damaging Het
Zfp652 A G 11: 95,749,329 S27G probably damaging Het
Zfp808 A G 13: 62,172,852 T632A possibly damaging Het
Znhit6 T C 3: 145,578,169 probably null Het
Other mutations in Has2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Has2 APN 15 56681676 missense possibly damaging 0.51
IGL02027:Has2 APN 15 56668171 missense probably damaging 1.00
IGL02178:Has2 APN 15 56682060 missense probably damaging 1.00
IGL02493:Has2 APN 15 56667924 missense probably damaging 1.00
IGL02533:Has2 APN 15 56681695 missense probably benign 0.00
IGL03142:Has2 APN 15 56682095 missense possibly damaging 0.92
IGL03240:Has2 APN 15 56668260 missense probably damaging 1.00
R0189:Has2 UTSW 15 56668435 missense probably damaging 1.00
R0362:Has2 UTSW 15 56681661 missense probably damaging 1.00
R1377:Has2 UTSW 15 56681806 missense probably damaging 1.00
R1762:Has2 UTSW 15 56681610 missense probably benign 0.13
R1845:Has2 UTSW 15 56668578 missense probably damaging 1.00
R2012:Has2 UTSW 15 56667868 missense probably damaging 1.00
R2190:Has2 UTSW 15 56667787 missense probably benign 0.00
R2966:Has2 UTSW 15 56682137 missense probably damaging 1.00
R4361:Has2 UTSW 15 56681948 missense probably damaging 1.00
R5698:Has2 UTSW 15 56667916 missense probably damaging 1.00
R5826:Has2 UTSW 15 56668102 missense probably damaging 1.00
R5883:Has2 UTSW 15 56668063 missense possibly damaging 0.49
R5942:Has2 UTSW 15 56667796 nonsense probably null
R6433:Has2 UTSW 15 56667798 missense possibly damaging 0.79
R6560:Has2 UTSW 15 56668264 missense probably damaging 1.00
R6603:Has2 UTSW 15 56668572 missense probably damaging 1.00
R7094:Has2 UTSW 15 56681621 missense probably damaging 1.00
R7597:Has2 UTSW 15 56668421 missense probably damaging 1.00
R7738:Has2 UTSW 15 56667712 missense possibly damaging 0.89
R8060:Has2 UTSW 15 56669945 missense probably benign 0.00
Z1177:Has2 UTSW 15 56681583 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGCTCTGAAGGCTGTGTAC -3'
(R):5'- CATTTGGACTGTACGGTGCC -3'

Sequencing Primer
(F):5'- CTCTGAAGGCTGTGTACATGAC -3'
(R):5'- GCCTTTTTGGAACACCGGAAAATG -3'
Posted On2014-12-04