Incidental Mutation 'R2964:Gsdma2'
ID255983
Institutional Source Beutler Lab
Gene Symbol Gsdma2
Ensembl Gene ENSMUSG00000017211
Gene Namegasdermin A2
Synonyms2210411P14Rik, 2210006M16Rik, 2200001G21Rik, 2210009F20Rik, Gsdm2, Gsdml2
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98646759-98657964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98657259 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 184 (S184P)
Ref Sequence ENSEMBL: ENSMUSP00000017355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017355] [ENSMUST00000093938]
Predicted Effect probably damaging
Transcript: ENSMUST00000017355
AA Change: S184P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017355
Gene: ENSMUSG00000017211
AA Change: S184P

DomainStartEndE-ValueType
Pfam:Gasdermin 6 251 2.9e-73 PFAM
low complexity region 259 273 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093938
AA Change: S351P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091470
Gene: ENSMUSG00000017211
AA Change: S351P

DomainStartEndE-ValueType
Pfam:Gasdermin 3 418 9.5e-144 PFAM
low complexity region 426 440 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129186
Meta Mutation Damage Score 0.3510 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Gsdma2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Gsdma2 APN 11 98650974 missense probably damaging 1.00
IGL03091:Gsdma2 APN 11 98652002 missense probably damaging 1.00
IGL03252:Gsdma2 APN 11 98649090 missense probably damaging 1.00
IGL03279:Gsdma2 APN 11 98657723 missense unknown
R0116:Gsdma2 UTSW 11 98649183 missense probably damaging 1.00
R0443:Gsdma2 UTSW 11 98657688 missense probably damaging 1.00
R0521:Gsdma2 UTSW 11 98654901 nonsense probably null
R0626:Gsdma2 UTSW 11 98651984 missense probably damaging 0.96
R1163:Gsdma2 UTSW 11 98650858 missense probably damaging 0.96
R1340:Gsdma2 UTSW 11 98657649 missense probably damaging 0.97
R1834:Gsdma2 UTSW 11 98649079 missense probably damaging 1.00
R1972:Gsdma2 UTSW 11 98650918 missense probably benign 0.04
R2344:Gsdma2 UTSW 11 98655591 missense probably damaging 1.00
R4093:Gsdma2 UTSW 11 98650851 missense probably benign 0.42
R4256:Gsdma2 UTSW 11 98651932 intron probably null
R4711:Gsdma2 UTSW 11 98649613 missense probably damaging 0.96
R5175:Gsdma2 UTSW 11 98652612 missense probably benign 0.01
R6734:Gsdma2 UTSW 11 98649590 missense possibly damaging 0.94
R6909:Gsdma2 UTSW 11 98652557 nonsense probably null
R7621:Gsdma2 UTSW 11 98649549 missense probably benign
R7749:Gsdma2 UTSW 11 98657721 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGCAGGTGTTCATCTGTG -3'
(R):5'- GGGAGAGGGGAAGACTTTTCTC -3'

Sequencing Primer
(F):5'- AGAGCAGGTGTTCATCTGTGGATAG -3'
(R):5'- GAAGACTTTTCTCTAGGGATAAGGC -3'
Posted On2014-12-29