Incidental Mutation 'R3703:Mug1'
ID258606
Institutional Source Beutler Lab
Gene Symbol Mug1
Ensembl Gene ENSMUSG00000059908
Gene Namemurinoglobulin 1
Synonyms
MMRRC Submission 040696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3703 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121838541-121889057 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 121888556 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032228]
Predicted Effect probably benign
Transcript: ENSMUST00000032228
SMART Domains Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 5e-21 PFAM
A2M_N_2 449 599 2.55e-41 SMART
A2M 740 830 5.43e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
Pfam:A2M_comp 1012 1268 5.4e-94 PFAM
A2M_recep 1378 1465 4.14e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204210
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
Arhgap10 C T 8: 77,259,056 probably null Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brf1 T C 12: 112,969,371 probably null Het
Btnl7-ps T A 17: 34,533,967 noncoding transcript Het
Cdh12 C A 15: 21,583,826 T584K probably damaging Het
Col13a1 A G 10: 61,867,829 probably null Het
Col25a1 A G 3: 130,550,033 probably null Het
Csrp2 G A 10: 110,937,874 probably benign Het
Ctla2a T A 13: 60,936,007 D37V probably damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dxo T C 17: 34,838,769 probably benign Het
Edil3 A T 13: 89,177,298 M269L probably benign Het
Fbxl7 C A 15: 26,543,755 G269C probably damaging Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hnrnpul2 A G 19: 8,824,409 E327G probably damaging Het
Ifi207 A T 1: 173,727,463 Y884* probably null Het
Ifi47 T C 11: 49,095,525 S40P probably benign Het
Kcnq3 A G 15: 66,021,739 probably null Het
Kifc3 G A 8: 95,104,028 probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh2 A G 11: 67,189,601 I1214V probably benign Het
Naa30 A G 14: 49,187,602 N337S probably benign Het
Nap1l3 A T X: 122,395,524 I499N possibly damaging Het
Nfat5 T A 8: 107,351,421 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nt5c3 A G 6: 56,883,667 probably benign Het
Pklr C T 3: 89,142,701 R328C probably damaging Het
Prrc2c G A 1: 162,710,691 R457C probably damaging Het
Rab1a T G 11: 20,224,506 probably benign Het
Rasa3 A T 8: 13,588,972 D278E probably benign Het
Rdh8 C T 9: 20,823,333 P99S probably damaging Het
Snx9 T A 17: 5,928,200 probably null Het
Spns3 C T 11: 72,499,530 probably benign Het
Sympk A G 7: 19,040,561 Y421C probably damaging Het
Tas1r2 G A 4: 139,667,418 C495Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Tmprss15 T C 16: 79,054,142 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Trdmt1 T A 2: 13,521,297 Q170L probably benign Het
Ttn A T 2: 76,735,408 V28200D probably damaging Het
Zfp616 G A 11: 74,083,319 W138* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Mug1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mug1 APN 6 121865809 missense probably damaging 1.00
IGL00485:Mug1 APN 6 121887416 missense probably benign 0.17
IGL00816:Mug1 APN 6 121882638 missense probably damaging 0.99
IGL01140:Mug1 APN 6 121882734 missense probably benign 0.01
IGL01141:Mug1 APN 6 121870499 missense probably benign 0.08
IGL01384:Mug1 APN 6 121849474 splice site probably benign
IGL01659:Mug1 APN 6 121870660 splice site probably benign
IGL02049:Mug1 APN 6 121871336 missense probably benign
IGL02151:Mug1 APN 6 121884690 critical splice donor site probably null
IGL02315:Mug1 APN 6 121840167 missense probably benign
IGL02629:Mug1 APN 6 121840065 missense possibly damaging 0.62
IGL02642:Mug1 APN 6 121882585 missense probably benign 0.14
IGL02807:Mug1 APN 6 121886572 missense probably damaging 0.96
IGL02932:Mug1 APN 6 121887427 missense probably benign 0.35
IGL03232:Mug1 APN 6 121878535 missense probably benign 0.00
R1462_Mug1_304 UTSW 6 121882629 missense probably benign 0.41
R2341_Mug1_749 UTSW 6 121884629 missense probably benign 0.06
R4261_Mug1_652 UTSW 6 121873734 missense probably benign
R6173_mug1_139 UTSW 6 121863793 missense probably damaging 0.99
IGL03050:Mug1 UTSW 6 121880571 missense possibly damaging 0.90
R0101:Mug1 UTSW 6 121884247 missense possibly damaging 0.59
R0194:Mug1 UTSW 6 121840107 missense probably damaging 0.98
R0196:Mug1 UTSW 6 121838725 critical splice donor site probably null
R0325:Mug1 UTSW 6 121849842 missense probably benign
R0332:Mug1 UTSW 6 121849897 splice site probably null
R0377:Mug1 UTSW 6 121857361 missense probably benign 0.02
R0393:Mug1 UTSW 6 121849850 missense possibly damaging 0.64
R0414:Mug1 UTSW 6 121856554 missense probably benign 0.00
R0457:Mug1 UTSW 6 121861555 missense probably benign 0.06
R0479:Mug1 UTSW 6 121840227 missense probably benign
R0519:Mug1 UTSW 6 121851424 missense possibly damaging 0.83
R0535:Mug1 UTSW 6 121851454 missense probably benign
R0745:Mug1 UTSW 6 121887427 missense probably benign 0.35
R0939:Mug1 UTSW 6 121884349 missense possibly damaging 0.95
R0975:Mug1 UTSW 6 121878539 missense probably damaging 0.99
R1033:Mug1 UTSW 6 121880551 missense probably damaging 0.99
R1086:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R1116:Mug1 UTSW 6 121870645 missense probably benign
R1131:Mug1 UTSW 6 121861185 missense probably benign 0.18
R1249:Mug1 UTSW 6 121849461 missense probably benign 0.07
R1364:Mug1 UTSW 6 121881713 missense probably damaging 1.00
R1418:Mug1 UTSW 6 121838676 missense probably benign 0.00
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1494:Mug1 UTSW 6 121879300 missense probably damaging 1.00
R1639:Mug1 UTSW 6 121880571 missense probably damaging 1.00
R1901:Mug1 UTSW 6 121881821 missense probably benign
R1902:Mug1 UTSW 6 121881821 missense probably benign
R2087:Mug1 UTSW 6 121856291 missense probably benign 0.00
R2168:Mug1 UTSW 6 121870499 missense probably benign 0.08
R2249:Mug1 UTSW 6 121870510 missense probably benign
R2341:Mug1 UTSW 6 121884629 missense probably benign 0.06
R2888:Mug1 UTSW 6 121881843 missense probably benign 0.44
R2892:Mug1 UTSW 6 121840070 missense possibly damaging 0.91
R3789:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3790:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3950:Mug1 UTSW 6 121878530 missense probably damaging 1.00
R4261:Mug1 UTSW 6 121873734 missense probably benign
R4402:Mug1 UTSW 6 121879352 missense probably damaging 1.00
R4589:Mug1 UTSW 6 121857351 missense probably benign 0.19
R4707:Mug1 UTSW 6 121884641 missense probably damaging 1.00
R4766:Mug1 UTSW 6 121884254 missense probably benign 0.01
R4840:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R4984:Mug1 UTSW 6 121838617 utr 5 prime probably benign
R4999:Mug1 UTSW 6 121878943 nonsense probably null
R5198:Mug1 UTSW 6 121874562 missense probably damaging 1.00
R5220:Mug1 UTSW 6 121861133 missense probably benign 0.03
R5253:Mug1 UTSW 6 121888913 missense probably benign 0.03
R5273:Mug1 UTSW 6 121873789 missense probably damaging 0.99
R5285:Mug1 UTSW 6 121841107 missense probably benign 0.45
R5387:Mug1 UTSW 6 121884394 missense probably damaging 0.99
R5560:Mug1 UTSW 6 121861073 missense probably damaging 0.96
R5652:Mug1 UTSW 6 121840181 missense probably benign
R5704:Mug1 UTSW 6 121851433 missense possibly damaging 0.63
R5732:Mug1 UTSW 6 121878493 missense probably benign 0.00
R6053:Mug1 UTSW 6 121865738 missense probably benign 0.00
R6173:Mug1 UTSW 6 121863793 missense probably damaging 0.99
R6578:Mug1 UTSW 6 121887452 missense probably benign 0.00
R6647:Mug1 UTSW 6 121840241 missense probably benign 0.02
R6681:Mug1 UTSW 6 121838724 missense possibly damaging 0.75
R6925:Mug1 UTSW 6 121881787 missense probably damaging 1.00
R7014:Mug1 UTSW 6 121861125 missense probably benign 0.22
R7031:Mug1 UTSW 6 121838714 missense probably benign 0.00
R7034:Mug1 UTSW 6 121873644 missense probably benign 0.00
R7156:Mug1 UTSW 6 121880905 missense probably damaging 1.00
R7156:Mug1 UTSW 6 121884343 missense probably damaging 1.00
R7179:Mug1 UTSW 6 121857420 missense probably benign 0.00
R7211:Mug1 UTSW 6 121880539 missense possibly damaging 0.52
R7318:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7462:Mug1 UTSW 6 121875440 missense probably benign 0.00
R7479:Mug1 UTSW 6 121878508 missense possibly damaging 0.83
R7588:Mug1 UTSW 6 121875517 missense probably damaging 1.00
R7611:Mug1 UTSW 6 121875428 critical splice acceptor site probably null
R7659:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7660:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7661:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7663:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7664:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7666:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7788:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7789:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7794:Mug1 UTSW 6 121856288 missense possibly damaging 0.93
R7809:Mug1 UTSW 6 121878985 missense possibly damaging 0.79
R7836:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7867:Mug1 UTSW 6 121873634 missense probably benign
R7904:Mug1 UTSW 6 121851465 missense probably benign
R7937:Mug1 UTSW 6 121861169 missense probably benign 0.00
R7981:Mug1 UTSW 6 121881764 missense probably damaging 1.00
R7999:Mug1 UTSW 6 121880896 missense possibly damaging 0.90
R8070:Mug1 UTSW 6 121875879 missense probably benign 0.26
R8071:Mug1 UTSW 6 121873672 missense probably benign
R8151:Mug1 UTSW 6 121841158 missense probably benign 0.01
R8491:Mug1 UTSW 6 121882729 missense probably damaging 1.00
R8714:Mug1 UTSW 6 121882722 missense probably benign 0.01
R8734:Mug1 UTSW 6 121871381 missense probably benign 0.00
R8807:Mug1 UTSW 6 121874475 missense probably benign 0.27
R8931:Mug1 UTSW 6 121884337 missense probably benign
R8940:Mug1 UTSW 6 121881683 missense
RF017:Mug1 UTSW 6 121884574 missense probably damaging 1.00
X0064:Mug1 UTSW 6 121861215 missense possibly damaging 0.48
Z1176:Mug1 UTSW 6 121841294 missense probably benign 0.32
Z1176:Mug1 UTSW 6 121880493 missense probably damaging 1.00
Z1177:Mug1 UTSW 6 121863808 missense probably damaging 0.99
Z1177:Mug1 UTSW 6 121879299 critical splice acceptor site probably null
Z1177:Mug1 UTSW 6 121886568 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCAACCAGTAGCTTGAAGGG -3'
(R):5'- ATGGAGAATGGTGTCCTTCAG -3'

Sequencing Primer
(F):5'- CCAGTAGCTTGAAGGGAAGAAATTCC -3'
(R):5'- CTGGAATGCCAATCCAAATGTG -3'
Posted On2015-01-23