Incidental Mutation 'R1462:Mug1'
ID186304
Institutional Source Beutler Lab
Gene Symbol Mug1
Ensembl Gene ENSMUSG00000059908
Gene Namemurinoglobulin 1
Synonyms
MMRRC Submission 039516-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1462 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121838541-121889057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121882629 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 1196 (H1196Y)
Ref Sequence ENSEMBL: ENSMUSP00000032228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032228]
Predicted Effect probably benign
Transcript: ENSMUST00000032228
AA Change: H1196Y

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908
AA Change: H1196Y

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 5e-21 PFAM
A2M_N_2 449 599 2.55e-41 SMART
A2M 740 830 5.43e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
Pfam:A2M_comp 1012 1268 5.4e-94 PFAM
A2M_recep 1378 1465 4.14e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204210
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C A 7: 40,992,946 S104* probably null Het
A430093F15Rik A T 19: 10,785,481 probably benign Het
Abca13 T A 11: 9,483,924 probably benign Het
Abca9 T C 11: 110,160,516 D118G probably benign Het
AC239677.1 T A 5: 25,951,625 I119F possibly damaging Het
Adamts16 A G 13: 70,836,134 F137L probably benign Het
Adamts3 T C 5: 89,861,349 I152V probably benign Het
Adcy4 T A 14: 55,778,308 E441D possibly damaging Het
Adgra1 T A 7: 139,875,829 Y458N probably damaging Het
Atpaf1 C T 4: 115,784,953 probably benign Het
Bhlhe22 C G 3: 18,055,782 S332C probably damaging Het
Card19 T A 13: 49,205,284 Q71L probably benign Het
Ccdc12 T C 9: 110,656,594 L11P probably damaging Het
Ccdc129 A G 6: 55,975,664 H864R probably damaging Het
Cdadc1 A G 14: 59,575,858 Y367H probably damaging Het
Cdc5l G T 17: 45,408,362 Q542K possibly damaging Het
Cep170 T C 1: 176,756,645 K723E possibly damaging Het
Cep70 A G 9: 99,263,720 I147V probably benign Het
Cfap58 A T 19: 47,962,430 H410L probably damaging Het
Chat T C 14: 32,420,778 K418R probably damaging Het
Cic T G 7: 25,271,607 D254E probably damaging Het
Ckap4 T C 10: 84,527,567 E544G probably damaging Het
Crnkl1 C T 2: 145,921,819 A500T probably damaging Het
Cyp2c38 T C 19: 39,392,188 N418D probably damaging Het
Daam1 A T 12: 71,944,142 I177L unknown Het
Dnah1 T C 14: 31,268,781 probably benign Het
Ercc5 A G 1: 44,180,624 T1019A probably damaging Het
F13b T A 1: 139,507,636 V173E probably damaging Het
Fam126a A G 5: 23,985,732 probably benign Het
Fam135b A G 15: 71,621,996 probably benign Het
Fam20a A C 11: 109,677,317 F316V probably damaging Het
Flrt2 T C 12: 95,779,338 V150A probably damaging Het
Fnta A C 8: 25,999,571 probably null Het
Ghsr A G 3: 27,371,876 D27G probably benign Het
Glis3 G T 19: 28,262,518 probably benign Het
Gm5155 T G 7: 17,915,591 noncoding transcript Het
Gtpbp1 A G 15: 79,707,885 N96D probably damaging Het
H1fnt A T 15: 98,256,573 W232R unknown Het
Ibtk A T 9: 85,724,145 I443N probably damaging Het
Ifi207 T C 1: 173,724,947 H968R probably damaging Het
Ifit2 A G 19: 34,573,186 D42G probably null Het
Il17rc A T 6: 113,478,989 D265V probably damaging Het
Ints10 G A 8: 68,807,644 probably benign Het
Itfg2 T C 6: 128,424,728 D29G probably damaging Het
Kcng3 A T 17: 83,631,063 C186S probably damaging Het
Lrrc1 A G 9: 77,442,265 F295L probably benign Het
Mrps28 T A 3: 8,900,124 H85L possibly damaging Het
Mtpn T A 6: 35,522,758 K37M possibly damaging Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Musk A G 4: 58,286,204 probably benign Het
Mybl2 T C 2: 163,072,708 S249P probably benign Het
Naip6 A G 13: 100,300,240 Y592H possibly damaging Het
Nrp1 A G 8: 128,502,798 N919S probably benign Het
Nudt9 C T 5: 104,065,038 Q326* probably null Het
Olfr1136 A T 2: 87,693,376 C169S probably damaging Het
Olfr813 A G 10: 129,857,231 T238A probably damaging Het
Olfr827 T A 10: 130,210,723 I136F probably benign Het
Olfr829 T A 9: 18,857,111 M162K probably benign Het
Pcsk4 T C 10: 80,325,981 E142G probably damaging Het
Pde3a C A 6: 141,459,834 P471T probably benign Het
Pign A T 1: 105,585,002 V652E possibly damaging Het
Prkcb T A 7: 122,582,449 M420K probably damaging Het
Prr14 T A 7: 127,473,988 probably null Het
Rchy1 T A 5: 91,957,882 Q69L probably damaging Het
Sccpdh A C 1: 179,681,560 probably benign Het
Sec23ip T G 7: 128,766,138 S625A probably benign Het
Smpdl3b A G 4: 132,746,614 S47P probably damaging Het
Stil G A 4: 115,023,964 M568I probably benign Het
Syt3 T A 7: 44,396,010 V558E probably damaging Het
Sytl3 A G 17: 6,706,031 probably benign Het
Szt2 A G 4: 118,373,967 V2533A unknown Het
Tenm4 A G 7: 96,704,153 Y384C probably damaging Het
Tfam T C 10: 71,235,550 E94G probably damaging Het
Tmbim7 A G 5: 3,664,304 T14A probably damaging Het
Tmtc2 A T 10: 105,573,705 Y15* probably null Het
Uhrf1 C T 17: 56,318,035 A526V probably damaging Het
Vmn2r67 T C 7: 85,155,838 D22G probably benign Het
Vmn2r96 A G 17: 18,597,398 I412M possibly damaging Het
Vmn2r-ps69 T A 7: 85,310,352 noncoding transcript Het
Wdr17 A T 8: 54,670,328 I479K probably damaging Het
Wt1 T C 2: 105,166,831 V371A probably damaging Het
Zfp536 G T 7: 37,479,310 S226Y probably damaging Het
Zfp827 T C 8: 79,076,479 V560A probably benign Het
Other mutations in Mug1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mug1 APN 6 121865809 missense probably damaging 1.00
IGL00485:Mug1 APN 6 121887416 missense probably benign 0.17
IGL00816:Mug1 APN 6 121882638 missense probably damaging 0.99
IGL01140:Mug1 APN 6 121882734 missense probably benign 0.01
IGL01141:Mug1 APN 6 121870499 missense probably benign 0.08
IGL01384:Mug1 APN 6 121849474 splice site probably benign
IGL01659:Mug1 APN 6 121870660 splice site probably benign
IGL02049:Mug1 APN 6 121871336 missense probably benign
IGL02151:Mug1 APN 6 121884690 critical splice donor site probably null
IGL02315:Mug1 APN 6 121840167 missense probably benign
IGL02629:Mug1 APN 6 121840065 missense possibly damaging 0.62
IGL02642:Mug1 APN 6 121882585 missense probably benign 0.14
IGL02807:Mug1 APN 6 121886572 missense probably damaging 0.96
IGL02932:Mug1 APN 6 121887427 missense probably benign 0.35
IGL03232:Mug1 APN 6 121878535 missense probably benign 0.00
IGL03050:Mug1 UTSW 6 121880571 missense possibly damaging 0.90
R0101:Mug1 UTSW 6 121884247 missense possibly damaging 0.59
R0194:Mug1 UTSW 6 121840107 missense probably damaging 0.98
R0196:Mug1 UTSW 6 121838725 critical splice donor site probably null
R0325:Mug1 UTSW 6 121849842 missense probably benign
R0332:Mug1 UTSW 6 121849897 splice site probably null
R0377:Mug1 UTSW 6 121857361 missense probably benign 0.02
R0393:Mug1 UTSW 6 121849850 missense possibly damaging 0.64
R0414:Mug1 UTSW 6 121856554 missense probably benign 0.00
R0457:Mug1 UTSW 6 121861555 missense probably benign 0.06
R0479:Mug1 UTSW 6 121840227 missense probably benign
R0519:Mug1 UTSW 6 121851424 missense possibly damaging 0.83
R0535:Mug1 UTSW 6 121851454 missense probably benign
R0745:Mug1 UTSW 6 121887427 missense probably benign 0.35
R0939:Mug1 UTSW 6 121884349 missense possibly damaging 0.95
R0975:Mug1 UTSW 6 121878539 missense probably damaging 0.99
R1033:Mug1 UTSW 6 121880551 missense probably damaging 0.99
R1086:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R1116:Mug1 UTSW 6 121870645 missense probably benign
R1131:Mug1 UTSW 6 121861185 missense probably benign 0.18
R1249:Mug1 UTSW 6 121849461 missense probably benign 0.07
R1364:Mug1 UTSW 6 121881713 missense probably damaging 1.00
R1418:Mug1 UTSW 6 121838676 missense probably benign 0.00
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1494:Mug1 UTSW 6 121879300 missense probably damaging 1.00
R1639:Mug1 UTSW 6 121880571 missense probably damaging 1.00
R1901:Mug1 UTSW 6 121881821 missense probably benign
R1902:Mug1 UTSW 6 121881821 missense probably benign
R2087:Mug1 UTSW 6 121856291 missense probably benign 0.00
R2168:Mug1 UTSW 6 121870499 missense probably benign 0.08
R2249:Mug1 UTSW 6 121870510 missense probably benign
R2341:Mug1 UTSW 6 121884629 missense probably benign 0.06
R2888:Mug1 UTSW 6 121881843 missense probably benign 0.44
R2892:Mug1 UTSW 6 121840070 missense possibly damaging 0.91
R3703:Mug1 UTSW 6 121888556 splice site probably benign
R3789:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3790:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3950:Mug1 UTSW 6 121878530 missense probably damaging 1.00
R4261:Mug1 UTSW 6 121873734 missense probably benign
R4402:Mug1 UTSW 6 121879352 missense probably damaging 1.00
R4589:Mug1 UTSW 6 121857351 missense probably benign 0.19
R4707:Mug1 UTSW 6 121884641 missense probably damaging 1.00
R4766:Mug1 UTSW 6 121884254 missense probably benign 0.01
R4840:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R4984:Mug1 UTSW 6 121838617 utr 5 prime probably benign
R4999:Mug1 UTSW 6 121878943 nonsense probably null
R5198:Mug1 UTSW 6 121874562 missense probably damaging 1.00
R5220:Mug1 UTSW 6 121861133 missense probably benign 0.03
R5253:Mug1 UTSW 6 121888913 missense probably benign 0.03
R5273:Mug1 UTSW 6 121873789 missense probably damaging 0.99
R5285:Mug1 UTSW 6 121841107 missense probably benign 0.45
R5387:Mug1 UTSW 6 121884394 missense probably damaging 0.99
R5560:Mug1 UTSW 6 121861073 missense probably damaging 0.96
R5652:Mug1 UTSW 6 121840181 missense probably benign
R5704:Mug1 UTSW 6 121851433 missense possibly damaging 0.63
R5732:Mug1 UTSW 6 121878493 missense probably benign 0.00
R6053:Mug1 UTSW 6 121865738 missense probably benign 0.00
R6173:Mug1 UTSW 6 121863793 missense probably damaging 0.99
R6578:Mug1 UTSW 6 121887452 missense probably benign 0.00
R6647:Mug1 UTSW 6 121840241 missense probably benign 0.02
R6681:Mug1 UTSW 6 121838724 missense possibly damaging 0.75
R6925:Mug1 UTSW 6 121881787 missense probably damaging 1.00
R7014:Mug1 UTSW 6 121861125 missense probably benign 0.22
R7031:Mug1 UTSW 6 121838714 missense probably benign 0.00
R7034:Mug1 UTSW 6 121873644 missense probably benign 0.00
R7156:Mug1 UTSW 6 121880905 missense probably damaging 1.00
R7156:Mug1 UTSW 6 121884343 missense probably damaging 1.00
R7179:Mug1 UTSW 6 121857420 missense probably benign 0.00
R7211:Mug1 UTSW 6 121880539 missense possibly damaging 0.52
R7318:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7462:Mug1 UTSW 6 121875440 missense probably benign 0.00
R7479:Mug1 UTSW 6 121878508 missense possibly damaging 0.83
R7588:Mug1 UTSW 6 121875517 missense probably damaging 1.00
R7611:Mug1 UTSW 6 121875428 critical splice acceptor site probably null
R7659:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7660:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7661:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7663:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7664:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7666:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7788:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7789:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7794:Mug1 UTSW 6 121856288 missense possibly damaging 0.93
R7809:Mug1 UTSW 6 121878985 missense possibly damaging 0.79
R7836:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7867:Mug1 UTSW 6 121873634 missense probably benign
R7904:Mug1 UTSW 6 121851465 missense probably benign
R7919:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7950:Mug1 UTSW 6 121873634 missense probably benign
R7987:Mug1 UTSW 6 121851465 missense probably benign
R7999:Mug1 UTSW 6 121880896 missense possibly damaging 0.90
R8070:Mug1 UTSW 6 121875879 missense probably benign 0.26
RF017:Mug1 UTSW 6 121884574 missense probably damaging 1.00
X0064:Mug1 UTSW 6 121861215 missense possibly damaging 0.48
Z1176:Mug1 UTSW 6 121841294 missense probably benign 0.32
Z1176:Mug1 UTSW 6 121880493 missense probably damaging 1.00
Z1177:Mug1 UTSW 6 121863808 missense probably damaging 0.99
Z1177:Mug1 UTSW 6 121879299 critical splice acceptor site probably null
Z1177:Mug1 UTSW 6 121886568 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCATTGTCTCCTCAACTAGAGCAC -3'
(R):5'- GGGACTCTAATGGGAAACCACCAAC -3'

Sequencing Primer
(F):5'- TTAGCAAATCTGGGCATACTGG -3'
(R):5'- ACCACCAACCTGTGTGGAG -3'
Posted On2014-05-09