Incidental Mutation 'R3404:Fezf1'
ID259276
Institutional Source Beutler Lab
Gene Symbol Fezf1
Ensembl Gene ENSMUSG00000029697
Gene NameFez family zinc finger 1
SynonymsZfp312-like, 3110069A13Rik, Fez
MMRRC Submission 040622-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3404 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location23245044-23248362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23247284 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 264 (V264D)
Ref Sequence ENSEMBL: ENSMUSP00000031709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031709]
Predicted Effect probably benign
Transcript: ENSMUST00000031709
AA Change: V264D

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031709
Gene: ENSMUSG00000029697
AA Change: V264D

DomainStartEndE-ValueType
low complexity region 102 114 N/A INTRINSIC
ZnF_C2H2 260 282 1.58e-3 SMART
ZnF_C2H2 288 310 3.39e-3 SMART
ZnF_C2H2 316 338 1.38e-3 SMART
ZnF_C2H2 344 366 2.57e-3 SMART
ZnF_C2H2 372 394 2.53e-2 SMART
ZnF_C2H2 400 423 1.38e-3 SMART
low complexity region 441 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202489
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that belongs to the zinc finger double domain protein family. The encoded protein is thought to play a role in the embryonic migration of gonadotropin-releasing hormone neurons into the brain. Mutations in this gene are associated with hypogonadotropic hypogonadism-22 with anosmia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null mutation of this gene display neonatal lethality, impaired olfactory bulb development and impaired olfactory bulb interneuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C T 15: 64,699,600 V1065M probably damaging Het
Alg12 A T 15: 88,814,579 I181N probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankar T A 1: 72,643,093 K1220* probably null Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Baz1a C T 12: 54,916,989 S770N probably benign Het
Bcorl1 T A X: 48,371,007 M1139K probably benign Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Bnc2 G T 4: 84,546,241 N20K probably damaging Het
Brip1 T A 11: 86,143,263 N544I possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Cyp2c66 T C 19: 39,163,327 V162A probably benign Het
Dnaic1 A T 4: 41,603,246 E176D probably benign Het
Dnhd1 C T 7: 105,694,761 Q1771* probably null Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hspa13 C A 16: 75,758,026 E391* probably null Het
Ighv1-53 T A 12: 115,158,438 T106S possibly damaging Het
Immp2l T A 12: 41,110,847 L48* probably null Het
Itgam A G 7: 128,070,703 probably null Het
Ltn1 A T 16: 87,416,215 V486D probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mycbp2 C A 14: 103,200,114 C2104F probably damaging Het
Nlrp2 T C 7: 5,319,287 D49G probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Prkd1 C T 12: 50,648,904 A24T unknown Het
Pzp G A 6: 128,513,806 T398M probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rnf146 A G 10: 29,347,428 V154A possibly damaging Het
Senp7 T A 16: 56,188,277 W1007R probably damaging Het
Snx31 C T 15: 36,525,653 C300Y probably benign Het
Ticrr G C 7: 79,694,791 S1468T probably benign Het
Trim33 A G 3: 103,321,559 E327G probably damaging Het
Ubap2l T C 3: 90,038,850 E149G probably damaging Het
Ube4a A G 9: 44,929,687 S979P probably damaging Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vps13b T C 15: 35,926,054 S3834P probably damaging Het
Zfp609 A T 9: 65,701,172 M1142K possibly damaging Het
Zfp729b T G 13: 67,591,164 H994P probably damaging Het
Other mutations in Fezf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fezf1 APN 6 23247843 missense possibly damaging 0.76
IGL02538:Fezf1 APN 6 23246558 missense probably damaging 1.00
IGL02983:Fezf1 APN 6 23247872 missense probably damaging 0.99
IGL03372:Fezf1 APN 6 23246910 missense probably damaging 1.00
R0494:Fezf1 UTSW 6 23246055 missense probably damaging 1.00
R0612:Fezf1 UTSW 6 23247029 missense probably damaging 1.00
R0836:Fezf1 UTSW 6 23246999 missense probably benign 0.01
R1930:Fezf1 UTSW 6 23246907 missense probably damaging 1.00
R1931:Fezf1 UTSW 6 23246907 missense probably damaging 1.00
R2103:Fezf1 UTSW 6 23247332 missense possibly damaging 0.55
R2104:Fezf1 UTSW 6 23247332 missense possibly damaging 0.55
R2233:Fezf1 UTSW 6 23246003 missense probably damaging 1.00
R3950:Fezf1 UTSW 6 23247420 nonsense probably null
R4209:Fezf1 UTSW 6 23246617 missense probably damaging 0.99
R4400:Fezf1 UTSW 6 23247710 missense probably benign 0.22
R4614:Fezf1 UTSW 6 23247858 missense possibly damaging 0.71
R5287:Fezf1 UTSW 6 23248011 missense probably benign
R5878:Fezf1 UTSW 6 23247581 missense possibly damaging 0.71
R5943:Fezf1 UTSW 6 23246949 nonsense probably null
R5952:Fezf1 UTSW 6 23247428 missense probably benign 0.08
R6663:Fezf1 UTSW 6 23247528 missense probably damaging 1.00
R7158:Fezf1 UTSW 6 23245790 missense probably benign
R7184:Fezf1 UTSW 6 23247836 missense probably benign 0.31
R8679:Fezf1 UTSW 6 23247770 missense probably benign
X0025:Fezf1 UTSW 6 23247909 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAACGGAAGCACAGATTGGATCC -3'
(R):5'- TTGTACCGGCAGTGGAGAAAC -3'

Sequencing Primer
(F):5'- AGGGGGCAAAACAAGTTTATACTTCC -3'
(R):5'- CTCAGCTGCAGCATTACA -3'
Posted On2015-01-23