Incidental Mutation 'R2879:Ssc5d'
ID260226
Institutional Source Beutler Lab
Gene Symbol Ssc5d
Ensembl Gene ENSMUSG00000035279
Gene Namescavenger receptor cysteine rich family, 5 domains
Synonymss5d-srcrb, A430110N23Rik
MMRRC Submission 040467-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2879 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4925785-4944826 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to A at 4936907 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]
Predicted Effect probably null
Transcript: ENSMUST00000057612
SMART Domains Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SR 20 120 4.44e-49 SMART
low complexity region 141 155 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
SR 199 299 2.36e-53 SMART
SR 305 405 8.22e-53 SMART
low complexity region 437 462 N/A INTRINSIC
SR 464 565 1.11e-49 SMART
low complexity region 741 755 N/A INTRINSIC
SR 758 858 3.93e-50 SMART
low complexity region 936 957 N/A INTRINSIC
low complexity region 981 1004 N/A INTRINSIC
low complexity region 1018 1035 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1357 1364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207310
Predicted Effect probably benign
Transcript: ENSMUST00000208109
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Akap9 A G 5: 3,976,353 probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Ano6 T A 15: 95,943,427 C468* probably null Het
Arhgef10l G T 4: 140,515,287 H890Q probably benign Het
Ccnj T A 19: 40,844,714 L112Q probably damaging Het
Chaf1a T C 17: 56,044,114 probably null Het
Chchd4 A G 6: 91,465,218 S73P probably damaging Het
Chd3 T C 11: 69,364,098 K139E possibly damaging Het
Cyp2b13 T G 7: 26,086,031 probably null Het
Dagla T C 19: 10,271,084 I71V possibly damaging Het
Epor A T 9: 21,959,640 W315R probably damaging Het
Etv1 T A 12: 38,783,810 probably null Het
Fbn2 A T 18: 58,069,242 C1280S probably damaging Het
Fbxo2 G C 4: 148,166,011 R269P probably damaging Het
Fer1l4 A T 2: 156,052,200 L61Q probably damaging Het
Ggnbp2 C T 11: 84,832,971 probably null Het
Gm498 T A 7: 143,894,063 Y214* probably null Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Ibsp G A 5: 104,310,394 E266K possibly damaging Het
Lamb3 T A 1: 193,330,784 M439K possibly damaging Het
Lnx1 C T 5: 74,620,123 V246M probably benign Het
Lrrc32 A G 7: 98,499,777 Q588R probably benign Het
Magi2 A AG 5: 20,602,461 probably null Het
Med13 C T 11: 86,299,162 A974T possibly damaging Het
Mogat2 A T 7: 99,222,366 I246N possibly damaging Het
Myl2 T C 5: 122,104,685 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr406 T A 11: 74,270,223 V278D probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pik3r2 A G 8: 70,772,385 Y145H probably benign Het
Plg A G 17: 12,404,100 E509G possibly damaging Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ros1 C T 10: 52,172,840 probably null Het
Sbno1 A G 5: 124,388,572 M960T probably damaging Het
Smad1 T C 8: 79,353,455 probably null Het
Tfcp2 C T 15: 100,551,320 probably null Het
Tmem121 A G 12: 113,188,408 Y82C probably damaging Het
Tmem131 T C 1: 36,841,707 I161V possibly damaging Het
Tpp2 T A 1: 43,971,623 F523L probably damaging Het
Ttn C T 2: 76,771,505 silent Het
Ttpal A G 2: 163,615,583 probably null Het
Vdr T A 15: 97,859,127 Y288F probably benign Het
Wipf2 C T 11: 98,892,654 A302V probably benign Het
Zfp346 T G 13: 55,105,350 C3G possibly damaging Het
Other mutations in Ssc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ssc5d APN 7 4944481 missense possibly damaging 0.63
IGL00939:Ssc5d APN 7 4936281 missense possibly damaging 0.89
IGL01109:Ssc5d APN 7 4937112 nonsense probably null
IGL01409:Ssc5d APN 7 4942809 missense probably benign 0.16
IGL01880:Ssc5d APN 7 4933219 missense probably damaging 1.00
IGL02013:Ssc5d APN 7 4943836 missense probably benign 0.00
IGL02227:Ssc5d APN 7 4933454 critical splice donor site probably null
IGL02963:Ssc5d APN 7 4944327 missense probably benign 0.02
D4043:Ssc5d UTSW 7 4943983 missense possibly damaging 0.70
D4216:Ssc5d UTSW 7 4943983 missense possibly damaging 0.70
R0104:Ssc5d UTSW 7 4936286 missense probably benign 0.41
R0115:Ssc5d UTSW 7 4927881 unclassified probably benign
R0201:Ssc5d UTSW 7 4944663 missense probably benign
R0365:Ssc5d UTSW 7 4928467 nonsense probably null
R0485:Ssc5d UTSW 7 4937471 missense probably damaging 0.99
R0967:Ssc5d UTSW 7 4944343 nonsense probably null
R1607:Ssc5d UTSW 7 4944043 missense probably benign 0.25
R1639:Ssc5d UTSW 7 4928417 missense probably damaging 1.00
R1801:Ssc5d UTSW 7 4936607 missense probably benign 0.05
R1867:Ssc5d UTSW 7 4928507 missense probably damaging 1.00
R1999:Ssc5d UTSW 7 4942714 missense possibly damaging 0.86
R2007:Ssc5d UTSW 7 4928629 missense probably damaging 1.00
R2084:Ssc5d UTSW 7 4937012 missense probably benign 0.01
R2234:Ssc5d UTSW 7 4943850 missense probably benign
R2259:Ssc5d UTSW 7 4943916 missense probably benign 0.01
R2567:Ssc5d UTSW 7 4936335 missense probably damaging 1.00
R3782:Ssc5d UTSW 7 4942791 missense probably benign 0.00
R3875:Ssc5d UTSW 7 4927262 missense probably damaging 1.00
R4322:Ssc5d UTSW 7 4928450 missense probably damaging 1.00
R4331:Ssc5d UTSW 7 4942726 missense probably benign 0.00
R4334:Ssc5d UTSW 7 4943664 missense probably benign
R4430:Ssc5d UTSW 7 4943664 missense probably benign
R4619:Ssc5d UTSW 7 4929525 missense probably damaging 1.00
R4794:Ssc5d UTSW 7 4943745 missense probably benign
R5106:Ssc5d UTSW 7 4936665 missense probably benign 0.31
R5174:Ssc5d UTSW 7 4927971 missense possibly damaging 0.83
R5553:Ssc5d UTSW 7 4936290 missense probably damaging 1.00
R5649:Ssc5d UTSW 7 4926518 critical splice donor site probably null
R5786:Ssc5d UTSW 7 4936818 missense probably benign 0.00
R6059:Ssc5d UTSW 7 4942744 missense possibly damaging 0.86
R6163:Ssc5d UTSW 7 4927254 missense probably damaging 1.00
R6332:Ssc5d UTSW 7 4937522 missense probably damaging 1.00
R6341:Ssc5d UTSW 7 4936665 missense probably benign 0.31
R6613:Ssc5d UTSW 7 4933293 missense possibly damaging 0.82
R7180:Ssc5d UTSW 7 4936601 missense probably benign 0.17
R7576:Ssc5d UTSW 7 4928573 missense probably damaging 1.00
R7602:Ssc5d UTSW 7 4942746 missense possibly damaging 0.95
R7609:Ssc5d UTSW 7 4927576 missense possibly damaging 0.56
R7691:Ssc5d UTSW 7 4944169 missense probably benign 0.29
R7759:Ssc5d UTSW 7 4937530 nonsense probably null
X0063:Ssc5d UTSW 7 4936287 missense probably damaging 1.00
Z1088:Ssc5d UTSW 7 4928434 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCTCAGACCTCTTTGGAG -3'
(R):5'- ATGTCATCCAACCAGATGGGC -3'

Sequencing Primer
(F):5'- AGACCTCTTTGGAGCCATCG -3'
(R):5'- CCATAGTGAGTTTTGCCTACTCGG -3'
Posted On2015-01-23