Incidental Mutation 'R2877:Alg11'
ID260611
Institutional Source Beutler Lab
Gene Symbol Alg11
Ensembl Gene ENSMUSG00000063362
Gene Nameasparagine-linked glycosylation 11 (alpha-1,2-mannosyltransferase)
Synonyms
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22060721-22071627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22065358 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 170 (N170D)
Ref Sequence ENSEMBL: ENSMUSP00000106365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072572] [ENSMUST00000110737]
Predicted Effect probably benign
Transcript: ENSMUST00000072572
AA Change: N212D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072382
Gene: ENSMUSG00000063362
AA Change: N212D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:ALG11_N 62 269 2.6e-94 PFAM
Pfam:Glycos_transf_1 293 470 1.4e-30 PFAM
Pfam:Glyco_trans_1_4 301 454 8.3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110737
AA Change: N170D

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106365
Gene: ENSMUSG00000063362
AA Change: N170D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
Pfam:Glycos_transf_1 248 428 3.8e-29 PFAM
Pfam:Glyco_trans_1_4 259 412 7.1e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000131624
AA Change: N130D
SMART Domains Protein: ENSMUSP00000119161
Gene: ENSMUSG00000063362
AA Change: N130D

DomainStartEndE-ValueType
Pfam:ALG11_N 4 160 1.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134474
Meta Mutation Damage Score 0.1169 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase which is localized to the cytosolic side of the endoplasmic reticulum (ER) and catalyzes the transfer of the fourth and fifth mannose residue from GDP-mannose (GDP-Man) to Man3GlcNAc2-PP-dolichol and Man4GlcNAc2-PP-dolichol resulting in the production of Man5GlcNAc2-PP-dolichol. Mutations in this gene are associated with congenital disorder of glycosylation type Ip (CDGIP). This gene overlaps but is distinct from the UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) gene. A pseudogene of the GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase has been identified on chromosome 19. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Alg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02612:Alg11 APN 8 22061983 missense probably benign 0.22
1mM(1):Alg11 UTSW 8 22074057 missense probably benign
R0240:Alg11 UTSW 8 22065452 missense possibly damaging 0.83
R1908:Alg11 UTSW 8 22065568 missense probably damaging 1.00
R1980:Alg11 UTSW 8 22061887 missense possibly damaging 0.69
R2090:Alg11 UTSW 8 22065630 missense possibly damaging 0.80
R2147:Alg11 UTSW 8 22065293 missense probably damaging 1.00
R2159:Alg11 UTSW 8 22065845 missense probably benign 0.44
R2265:Alg11 UTSW 8 22065614 missense probably benign
R2760:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2761:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2762:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2763:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2764:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4165:Alg11 UTSW 8 22065557 missense probably damaging 1.00
R4230:Alg11 UTSW 8 22065518 missense probably damaging 1.00
R4370:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4371:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4447:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4448:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4450:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4840:Alg11 UTSW 8 22068010 missense possibly damaging 0.91
R5859:Alg11 UTSW 8 22065841 missense probably benign 0.10
R5988:Alg11 UTSW 8 22062028 missense probably benign 0.00
R7293:Alg11 UTSW 8 22065379 missense probably damaging 1.00
R7417:Alg11 UTSW 8 22062028 missense probably benign 0.00
R7610:Alg11 UTSW 8 22065131 missense probably damaging 1.00
R8388:Alg11 UTSW 8 22062034 missense probably benign 0.03
X0019:Alg11 UTSW 8 22065424 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCACTTCACATTGCTAGGCC -3'
(R):5'- AGACAATGTTAGTGCAATGCCC -3'

Sequencing Primer
(F):5'- CACATTGCTAGGCCAAAGTCTTG -3'
(R):5'- CAACCTTCCACAGTGAGAGGATATG -3'
Posted On2015-01-23