Mutagenetix > Incidental Mutation

Incidental Mutation 'R6267:Kif13b'

507108

Institutional Source

Beutler Lab

Gene Symbol

Kif13b

Ensembl Gene

ENSMUSG00000060012

Gene Name

kinesin family member 13B

Synonyms

N-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN

MMRRC Submission

044405-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6267 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64647265-64809617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64738634 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 466 (Y466C)

Ref Sequence

ENSEMBL: ENSMUSP00000153168 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]

AlphaFold

A0A286YCV9

Predicted Effect

probably damaging
Transcript: ENSMUST00000100473
AA Change: Y466C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012
AA Change: Y466C

Domain	Start	End	E-Value	Type
KISc	3	361	1.4e-182	SMART
FHA	470	520	6.86e-1	SMART
low complexity region	546	560	N/A	INTRINSIC
coiled coil region	617	646	N/A	INTRINSIC
coiled coil region	669	701	N/A	INTRINSIC
Pfam:KIF1B	756	802	4.1e-20	PFAM
Pfam:DUF3694	1003	1279	1.4e-37	PFAM
low complexity region	1514	1526	N/A	INTRINSIC
low complexity region	1532	1548	N/A	INTRINSIC
low complexity region	1574	1589	N/A	INTRINSIC
low complexity region	1617	1630	N/A	INTRINSIC
CAP_GLY	1719	1784	1.54e-29	SMART
low complexity region	1814	1826	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000224503
AA Change: Y466C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,683	D441G	probably benign	Het
4933427D14Rik	T	C	11: 72,195,754	K277R	probably damaging	Het
Aatf	T	C	11: 84,473,100	Y267C	probably benign	Het
Abi3bp	A	G	16: 56,594,497	T341A	probably damaging	Het
Acer2	T	C	4: 86,874,586	F33S	probably damaging	Het
Actr1b	A	G	1: 36,701,163	V299A	possibly damaging	Het
Ampd3	T	A	7: 110,791,180		probably null	Het
Atm	A	C	9: 53,444,000	I2898R	probably damaging	Het
Bpifb6	G	C	2: 153,906,892	K269N	possibly damaging	Het
Cacna1c	T	C	6: 118,598,723	E1927G	possibly damaging	Het
Cacna1c	T	A	6: 118,652,714	T1249S	probably benign	Het
Cars2	TCCCC	TCCC	8: 11,529,599		probably null	Het
Cbll1	A	G	12: 31,487,508	V415A	probably benign	Het
Cd300lf	C	T	11: 115,124,369	V132I	probably benign	Het
Chd2	T	C	7: 73,463,671	E1187G	probably damaging	Het
Cntrl	T	C	2: 35,129,793	L544P	probably damaging	Het
Cryga	A	C	1: 65,103,010	S75A	probably benign	Het
Dcbld1	T	A	10: 52,319,480	Y261*	probably null	Het
Ddx11	G	A	17: 66,150,729		probably null	Het
Dgke	C	T	11: 89,040,749	V560I	probably benign	Het
Dst	A	C	1: 34,228,672	D5065A	probably damaging	Het
Dusp16	C	A	6: 134,720,493		probably null	Het
Eif4enif1	T	A	11: 3,227,793	V395E	probably damaging	Het
Enox1	A	G	14: 77,577,764	T121A	probably damaging	Het
Enpp4	G	T	17: 44,102,480	N54K	probably benign	Het
Erc2	A	T	14: 28,080,155	K764M	probably damaging	Het
Ercc6	G	T	14: 32,526,403	E304*	probably null	Het
Fam117a	T	A	11: 95,364,145	C115S	possibly damaging	Het
Fcrl5	G	A	3: 87,448,324	G448E	probably damaging	Het
Galntl5	T	C	5: 25,186,165	S21P	probably benign	Het
Garnl3	T	C	2: 33,104,880	D39G	probably benign	Het
Gm14295	C	T	2: 176,808,989	Q91*	probably null	Het
Grb10	T	A	11: 11,970,639		probably benign	Het
Grip1	C	T	10: 120,075,464	Q696*	probably null	Het
Herc2	T	A	7: 56,153,166	C2112*	probably null	Het
Herc2	T	G	7: 56,204,718	L3797R	possibly damaging	Het
Ighm	T	C	12: 113,421,567	I258V	unknown	Het
Jarid2	T	A	13: 44,903,063	Y443N	possibly damaging	Het
Krtap4-6	T	A	11: 99,665,419	R161*	probably null	Het
Lingo4	G	A	3: 94,403,390	G545E	probably benign	Het
Lmo2	T	G	2: 103,970,601	V39G	possibly damaging	Het
Lor	C	A	3: 92,081,812	G56*	probably null	Het
Lrfn1	A	G	7: 28,459,744	R363G	probably benign	Het
Lrp1b	T	C	2: 40,657,525	D446G	probably benign	Het
Ltbp1	G	T	17: 75,005,989	G35V	possibly damaging	Het
Magel2	G	A	7: 62,378,679	V444M	probably damaging	Het
Mkx	A	T	18: 7,000,591		probably null	Het
Ms4a7	A	T	19: 11,333,295	I20N	possibly damaging	Het
Myo5b	A	G	18: 74,616,991	Y173C	probably damaging	Het
Nek1	C	T	8: 61,072,309	Q594*	probably null	Het
Nipbl	T	C	15: 8,300,895	M2349V	possibly damaging	Het
Nmnat2	A	T	1: 153,076,971	H102L	probably damaging	Het
Nup155	T	A	15: 8,153,155	C1201S	probably damaging	Het
Olfr1249	G	A	2: 89,630,631	T89I	probably damaging	Het
Olfr1373	C	A	11: 52,144,596	R311S	probably benign	Het
Olfr686	G	A	7: 105,203,392	T317I	probably damaging	Het
Osbpl1a	A	G	18: 12,819,503		probably null	Het
Pcnt	A	G	10: 76,385,798	V1998A	probably benign	Het
Pitpnc1	T	C	11: 107,226,266	H193R	probably damaging	Het
Pitpnm1	T	C	19: 4,110,522	L781P	probably damaging	Het
Prdm14	A	T	1: 13,118,936	C395S	probably damaging	Het
Prmt8	A	G	6: 127,711,804	I201T	probably damaging	Het
Pter	T	C	2: 12,978,541	V119A	probably damaging	Het
Rab11fip4	T	C	11: 79,690,829		probably null	Het
Rgs9	T	C	11: 109,268,987	N173S	probably benign	Het
Rorb	C	A	19: 18,977,857	V47L	possibly damaging	Het
Rtn4r	A	G	16: 18,151,182	Y158C	probably damaging	Het
Sdr16c5	C	T	4: 4,016,162	G88E	probably damaging	Het
Sfxn1	C	T	13: 54,093,880	T208I	probably benign	Het
Sgo2b	C	T	8: 63,927,793	M668I	probably benign	Het
Slc52a3	G	T	2: 152,007,609		probably null	Het
Smco1	A	T	16: 32,274,014	M168L	probably benign	Het
Spata31d1d	G	A	13: 59,728,464	T419I	possibly damaging	Het
Spink5	T	C	18: 44,014,757	S857P	probably damaging	Het
Stk35	T	A	2: 129,810,888	Y436*	probably null	Het
Tmem225	T	A	9: 40,148,435	I37N	probably damaging	Het
Unkl	T	C	17: 25,231,865	*232R	probably null	Het
Usp16	A	G	16: 87,483,191	N813S	probably benign	Het
Vmn1r128	A	T	7: 21,350,296	*308C	probably null	Het
Vmn2r45	A	G	7: 8,472,208	V607A	probably benign	Het
Vmn2r63	A	T	7: 42,928,635		probably null	Het
Wnk4	A	T	11: 101,273,998	N718Y	probably damaging	Het
Zfp503	G	C	14: 21,985,800	Y349*	probably null	Het
Zfp990	T	A	4: 145,538,103	F557Y	possibly damaging	Het

Other mutations in Kif13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Kif13b	APN	14	64669693	missense	possibly damaging	0.81
IGL00485:Kif13b	APN	14	64765073	missense	possibly damaging	0.88
IGL00495:Kif13b	APN	14	64714113	missense	probably benign	0.07
IGL00556:Kif13b	APN	14	64744888	missense	probably damaging	1.00
IGL00571:Kif13b	APN	14	64746417	missense	probably damaging	0.99
IGL00590:Kif13b	APN	14	64779462	missense	probably damaging	1.00
IGL01650:Kif13b	APN	14	64765145	missense	probably benign	0.00
IGL01730:Kif13b	APN	14	64750361	critical splice donor site	probably null
IGL01908:Kif13b	APN	14	64757558	missense	probably damaging	1.00
IGL02388:Kif13b	APN	14	64800358	missense	probably damaging	1.00
IGL02573:Kif13b	APN	14	64803431	missense	probably damaging	1.00
IGL02661:Kif13b	APN	14	64767691	missense	probably benign	0.06
IGL02794:Kif13b	APN	14	64803440	missense	probably benign	0.00
IGL02959:Kif13b	APN	14	64767717	missense	probably damaging	1.00
IGL02979:Kif13b	APN	14	64789697	missense	probably damaging	0.96
IGL03114:Kif13b	APN	14	64788448	missense	probably benign	0.00
R0024:Kif13b	UTSW	14	64750273	missense	probably benign	0.30
R0330:Kif13b	UTSW	14	64803220	missense	probably benign
R0376:Kif13b	UTSW	14	64757404	splice site	probably benign
R0571:Kif13b	UTSW	14	64751528	missense	probably damaging	1.00
R0718:Kif13b	UTSW	14	64751662	splice site	probably benign
R1144:Kif13b	UTSW	14	64714117	missense	probably benign	0.01
R1183:Kif13b	UTSW	14	64782377	missense	probably benign	0.00
R1264:Kif13b	UTSW	14	64776232	splice site	probably benign
R1497:Kif13b	UTSW	14	64736266	missense	probably damaging	0.99
R1579:Kif13b	UTSW	14	64782341	critical splice acceptor site	probably null
R1624:Kif13b	UTSW	14	64738619	missense	probably damaging	0.99
R1706:Kif13b	UTSW	14	64760666	splice site	probably benign
R2176:Kif13b	UTSW	14	64669671	missense	probably benign	0.01
R3727:Kif13b	UTSW	14	64765748	splice site	probably benign
R3785:Kif13b	UTSW	14	64800400	missense	probably benign	0.00
R3786:Kif13b	UTSW	14	64800400	missense	probably benign	0.00
R4088:Kif13b	UTSW	14	64767455	critical splice donor site	probably null
R4279:Kif13b	UTSW	14	64779356	missense	probably damaging	1.00
R4559:Kif13b	UTSW	14	64806132	missense	probably damaging	0.98
R4689:Kif13b	UTSW	14	64773064	missense	probably damaging	1.00
R4692:Kif13b	UTSW	14	64803575	missense	probably benign	0.05
R4878:Kif13b	UTSW	14	64806154	missense	probably benign	0.00
R4971:Kif13b	UTSW	14	64757562	missense	possibly damaging	0.90
R5037:Kif13b	UTSW	14	64758589	nonsense	probably null
R5119:Kif13b	UTSW	14	64757453	missense	probably benign	0.01
R5167:Kif13b	UTSW	14	64772935	missense	probably damaging	1.00
R5408:Kif13b	UTSW	14	64779689	critical splice acceptor site	probably null
R5437:Kif13b	UTSW	14	64806114	missense	probably damaging	0.99
R5756:Kif13b	UTSW	14	64736305	missense	probably damaging	1.00
R5838:Kif13b	UTSW	14	64737555	missense	probably damaging	1.00
R5891:Kif13b	UTSW	14	64788405	splice site	probably null
R6120:Kif13b	UTSW	14	64751558	missense	probably damaging	1.00
R6150:Kif13b	UTSW	14	64751639	missense	probably damaging	0.99
R6165:Kif13b	UTSW	14	64742311	missense	probably damaging	1.00
R6187:Kif13b	UTSW	14	64736215	missense	probably damaging	1.00
R6229:Kif13b	UTSW	14	64738567	missense	probably damaging	1.00
R6347:Kif13b	UTSW	14	64767619	missense	probably benign	0.26
R6479:Kif13b	UTSW	14	64751525	missense	probably benign	0.08
R6512:Kif13b	UTSW	14	64744874	critical splice acceptor site	probably null
R6851:Kif13b	UTSW	14	64773065	missense	probably damaging	1.00
R7131:Kif13b	UTSW	14	64773068	missense	probably damaging	1.00
R7217:Kif13b	UTSW	14	64773068	missense	probably damaging	1.00
R7398:Kif13b	UTSW	14	64757523	missense	probably null	0.02
R7427:Kif13b	UTSW	14	64788460	missense	probably benign
R7428:Kif13b	UTSW	14	64788460	missense	probably benign
R7573:Kif13b	UTSW	14	64803658	missense	probably benign	0.00
R7629:Kif13b	UTSW	14	64779335	nonsense	probably null
R7683:Kif13b	UTSW	14	64757507	missense	probably benign	0.24
R7835:Kif13b	UTSW	14	64767452	missense	probably benign	0.00
R7895:Kif13b	UTSW	14	64736149	missense	probably damaging	1.00
R8285:Kif13b	UTSW	14	64782376	missense	probably benign	0.03
R8374:Kif13b	UTSW	14	64788435	missense	probably damaging	0.97
R8467:Kif13b	UTSW	14	64758705	missense	probably damaging	0.96
R8804:Kif13b	UTSW	14	64750342	missense	probably damaging	0.99
R8859:Kif13b	UTSW	14	64742433	missense	probably benign	0.04
R8891:Kif13b	UTSW	14	64744877	missense	probably damaging	1.00
R9236:Kif13b	UTSW	14	64744934	missense	probably benign	0.22
R9446:Kif13b	UTSW	14	64747021	missense	probably damaging	1.00
R9589:Kif13b	UTSW	14	64776310	missense	possibly damaging	0.82
Z1176:Kif13b	UTSW	14	64803344	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGTGCTGGGAATCACCAC -3'
(R):5'- TACCAATCTCCTATCAAGTGTTGC -3'

Sequencing Primer
(F):5'- GGGAATCACCACTTCTCTGG -3'
(R):5'- CTCCTATCAAGTGTTGCTAAGTAAG -3'

Posted On

2018-03-15