Incidental Mutation 'R7217:Kif13b'
ID561552
Institutional Source Beutler Lab
Gene Symbol Kif13b
Ensembl Gene ENSMUSG00000060012
Gene Namekinesin family member 13B
SynonymsN-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7217 (G1)
Quality Score221.009
Status Validated
Chromosome14
Chromosomal Location64647265-64809617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64773068 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1272 (V1272A)
Ref Sequence ENSEMBL: ENSMUSP00000098041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]
Predicted Effect probably damaging
Transcript: ENSMUST00000100473
AA Change: V1272A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012
AA Change: V1272A

DomainStartEndE-ValueType
KISc 3 361 1.4e-182 SMART
FHA 470 520 6.86e-1 SMART
low complexity region 546 560 N/A INTRINSIC
coiled coil region 617 646 N/A INTRINSIC
coiled coil region 669 701 N/A INTRINSIC
Pfam:KIF1B 756 802 4.1e-20 PFAM
Pfam:DUF3694 1003 1279 1.4e-37 PFAM
low complexity region 1514 1526 N/A INTRINSIC
low complexity region 1532 1548 N/A INTRINSIC
low complexity region 1574 1589 N/A INTRINSIC
low complexity region 1617 1630 N/A INTRINSIC
CAP_GLY 1719 1784 1.54e-29 SMART
low complexity region 1814 1826 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224503
AA Change: V1272A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik C A 5: 138,646,926 H358N probably benign Het
Abcg3 A G 5: 104,939,228 F543L possibly damaging Het
Asnsd1 T C 1: 53,348,193 T92A probably damaging Het
Atg2a G T 19: 6,253,441 probably null Het
Aven T A 2: 112,630,846 N327K possibly damaging Het
Brd9 T C 13: 73,938,944 V116A probably damaging Het
Car14 A G 3: 95,899,317 S250P probably damaging Het
Ccdc138 T C 10: 58,509,600 I138T probably benign Het
Cmya5 A G 13: 93,090,430 Y2717H probably damaging Het
Eno1b C A 18: 48,047,679 T308K probably damaging Het
Epha3 T C 16: 63,552,494 T949A probably benign Het
Fcrl5 C T 3: 87,443,774 T197M probably damaging Het
Foxp2 A T 6: 15,416,024 Q664L unknown Het
Fsip2 A T 2: 82,989,068 K5048N possibly damaging Het
Gcnt4 T C 13: 96,946,310 L38P probably damaging Het
Gm11127 A C 17: 36,056,343 M329R probably benign Het
Gpr68 A G 12: 100,878,799 V162A possibly damaging Het
Grin3a A T 4: 49,770,741 M677K possibly damaging Het
Grm7 A G 6: 111,358,824 Y732C probably damaging Het
Hoxb4 A G 11: 96,319,080 E104G probably benign Het
Kat7 A G 11: 95,291,564 S237P possibly damaging Het
Kif20a T A 18: 34,629,560 H495Q probably benign Het
Lama1 A T 17: 67,764,673 T852S Het
Mep1b T A 18: 21,093,543 D487E probably benign Het
Mki67 T C 7: 135,704,182 T656A probably damaging Het
Mlh3 A G 12: 85,266,707 W902R probably benign Het
Muc16 A T 9: 18,644,076 Y3640* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Pkd1l2 A G 8: 116,995,797 I2424T probably benign Het
Prl8a2 A G 13: 27,351,015 E91G possibly damaging Het
Prpf18 A G 2: 4,645,624 V65A probably benign Het
Pxmp2 A G 5: 110,285,905 V34A probably damaging Het
Ranbp2 T G 10: 58,452,017 Y36D probably damaging Het
Rbm25 G A 12: 83,664,217 R368Q unknown Het
Rims2 C A 15: 39,476,489 L860M probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Scn8a A T 15: 100,970,227 M318L probably benign Het
Slc35b2 A G 17: 45,565,029 T55A probably benign Het
Trnp1 T C 4: 133,498,105 E118G possibly damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wdfy3 A T 5: 101,901,919 H1680Q probably damaging Het
Zfp131 A G 13: 119,775,841 I327T probably damaging Het
Zfp729b A G 13: 67,595,248 V66A probably damaging Het
Other mutations in Kif13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kif13b APN 14 64669693 missense possibly damaging 0.81
IGL00485:Kif13b APN 14 64765073 missense possibly damaging 0.88
IGL00495:Kif13b APN 14 64714113 missense probably benign 0.07
IGL00556:Kif13b APN 14 64744888 missense probably damaging 1.00
IGL00571:Kif13b APN 14 64746417 missense probably damaging 0.99
IGL00590:Kif13b APN 14 64779462 missense probably damaging 1.00
IGL01650:Kif13b APN 14 64765145 missense probably benign 0.00
IGL01730:Kif13b APN 14 64750361 critical splice donor site probably null
IGL01908:Kif13b APN 14 64757558 missense probably damaging 1.00
IGL02388:Kif13b APN 14 64800358 missense probably damaging 1.00
IGL02573:Kif13b APN 14 64803431 missense probably damaging 1.00
IGL02661:Kif13b APN 14 64767691 missense probably benign 0.06
IGL02794:Kif13b APN 14 64803440 missense probably benign 0.00
IGL02959:Kif13b APN 14 64767717 missense probably damaging 1.00
IGL02979:Kif13b APN 14 64789697 missense probably damaging 0.96
IGL03114:Kif13b APN 14 64788448 missense probably benign 0.00
R0024:Kif13b UTSW 14 64750273 missense probably benign 0.30
R0330:Kif13b UTSW 14 64803220 missense probably benign
R0376:Kif13b UTSW 14 64757404 splice site probably benign
R0571:Kif13b UTSW 14 64751528 missense probably damaging 1.00
R0718:Kif13b UTSW 14 64751662 splice site probably benign
R1144:Kif13b UTSW 14 64714117 missense probably benign 0.01
R1183:Kif13b UTSW 14 64782377 missense probably benign 0.00
R1264:Kif13b UTSW 14 64776232 splice site probably benign
R1497:Kif13b UTSW 14 64736266 missense probably damaging 0.99
R1579:Kif13b UTSW 14 64782341 critical splice acceptor site probably null
R1624:Kif13b UTSW 14 64738619 missense probably damaging 0.99
R1706:Kif13b UTSW 14 64760666 splice site probably benign
R2176:Kif13b UTSW 14 64669671 missense probably benign 0.01
R3727:Kif13b UTSW 14 64765748 splice site probably benign
R3785:Kif13b UTSW 14 64800400 missense probably benign 0.00
R3786:Kif13b UTSW 14 64800400 missense probably benign 0.00
R4088:Kif13b UTSW 14 64767455 critical splice donor site probably null
R4279:Kif13b UTSW 14 64779356 missense probably damaging 1.00
R4559:Kif13b UTSW 14 64806132 missense probably damaging 0.98
R4689:Kif13b UTSW 14 64773064 missense probably damaging 1.00
R4692:Kif13b UTSW 14 64803575 missense probably benign 0.05
R4878:Kif13b UTSW 14 64806154 missense probably benign 0.00
R4971:Kif13b UTSW 14 64757562 missense possibly damaging 0.90
R5037:Kif13b UTSW 14 64758589 nonsense probably null
R5119:Kif13b UTSW 14 64757453 missense probably benign 0.01
R5167:Kif13b UTSW 14 64772935 missense probably damaging 1.00
R5408:Kif13b UTSW 14 64779689 critical splice acceptor site probably null
R5437:Kif13b UTSW 14 64806114 missense probably damaging 0.99
R5756:Kif13b UTSW 14 64736305 missense probably damaging 1.00
R5838:Kif13b UTSW 14 64737555 missense probably damaging 1.00
R5891:Kif13b UTSW 14 64788405 splice site probably null
R6120:Kif13b UTSW 14 64751558 missense probably damaging 1.00
R6150:Kif13b UTSW 14 64751639 missense probably damaging 0.99
R6165:Kif13b UTSW 14 64742311 missense probably damaging 1.00
R6187:Kif13b UTSW 14 64736215 missense probably damaging 1.00
R6229:Kif13b UTSW 14 64738567 missense probably damaging 1.00
R6267:Kif13b UTSW 14 64738634 missense probably damaging 1.00
R6347:Kif13b UTSW 14 64767619 missense probably benign 0.26
R6479:Kif13b UTSW 14 64751525 missense probably benign 0.08
R6512:Kif13b UTSW 14 64744874 critical splice acceptor site probably null
R6851:Kif13b UTSW 14 64773065 missense probably damaging 1.00
R7131:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7398:Kif13b UTSW 14 64757523 missense probably null 0.02
R7427:Kif13b UTSW 14 64788460 missense probably benign
R7428:Kif13b UTSW 14 64788460 missense probably benign
R7573:Kif13b UTSW 14 64803658 missense probably benign 0.00
R7629:Kif13b UTSW 14 64779335 nonsense probably null
R7683:Kif13b UTSW 14 64757507 missense probably benign 0.24
R7835:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7895:Kif13b UTSW 14 64736149 missense probably damaging 1.00
R7918:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7978:Kif13b UTSW 14 64736149 missense probably damaging 1.00
Z1176:Kif13b UTSW 14 64803344 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGCCTTCACATGGAGAAG -3'
(R):5'- GAGCAAAGCCACTGGACTTC -3'

Sequencing Primer
(F):5'- AAGTGAAGTGCTGCCTTACC -3'
(R):5'- ACTGGACTTCCCCATGGCAG -3'
Posted On2019-06-26