Mutagenetix > Incidental Mutation

Incidental Mutation 'R4454:Atf6'

329070

Institutional Source

Beutler Lab

Gene Symbol

Atf6

Ensembl Gene

ENSMUSG00000026663

Gene Name

activating transcription factor 6

Synonyms

9130025P16Rik, ESTM49, Atf6alpha

MMRRC Submission

041714-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.155) question?

Stock #

R4454 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

170704674-170867771 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 170794039 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 471 (R471Q)

Ref Sequence

ENSEMBL: ENSMUSP00000027974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027974]

AlphaFold

F6VAN0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027974
AA Change: R471Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: R471Q

Domain	Start	End	E-Value	Type
low complexity region	78	101	N/A	INTRINSIC
low complexity region	109	121	N/A	INTRINSIC
low complexity region	168	178	N/A	INTRINSIC
BRLZ	291	355	2.72e-16	SMART
Blast:BRLZ	384	419	5e-6	BLAST
low complexity region	445	457	N/A	INTRINSIC
low complexity region	631	650	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182787

Meta Mutation Damage Score

0.2122

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	C	1: 37,624,753	E163G	probably damaging	Het
AI481877	T	C	4: 59,092,383	D266G	possibly damaging	Het
Ap4e1	T	A	2: 127,047,141	F509I	probably damaging	Het
Asmt	A	T	X: 170,672,721	M19L	probably benign	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Baiap3	T	A	17: 25,249,536	D250V	probably damaging	Het
C2cd4d	T	A	3: 94,363,747	F107I	probably damaging	Het
Cdkn2d	C	G	9: 21,290,889	V21L	probably benign	Het
Cldn6	T	C	17: 23,681,086		probably null	Het
Cpa5	A	G	6: 30,626,324	N228S	possibly damaging	Het
Crocc	T	C	4: 141,020,405	S1478G	possibly damaging	Het
Csmd1	A	T	8: 15,945,011	C2675S	probably damaging	Het
Cthrc1	C	A	15: 39,077,013	Q4K	probably benign	Het
Ddo	A	T	10: 40,647,547	I178F	probably damaging	Het
Dmxl1	A	G	18: 49,893,332	T1836A	probably benign	Het
Dnah9	T	G	11: 66,147,389	Q107P	probably damaging	Het
Dusp26	A	G	8: 31,094,144	N93S	probably damaging	Het
Egr2	GAA	GA	10: 67,539,903		probably null	Het
Epha5	T	C	5: 84,156,444	I501V	probably damaging	Het
Eya1	C	T	1: 14,183,196	V519M	probably damaging	Het
Fam227b	T	A	2: 126,146,268		probably benign	Het
Fgd5	C	T	6: 91,989,186	S642F	probably damaging	Het
Fsip2	G	T	2: 82,990,776	A5618S	possibly damaging	Het
Gm12034	T	A	11: 20,446,476		noncoding transcript	Het
Gm13023	A	G	4: 143,792,824	S52G	probably benign	Het
Liph	T	C	16: 21,984,268	D17G	probably benign	Het
Mbd3	A	T	10: 80,393,983	L164H	probably damaging	Het
Med4	A	G	14: 73,518,062		probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Nav2	A	T	7: 49,548,544		probably null	Het
Olfr728	T	C	14: 50,140,496	I48V	probably benign	Het
Olfr904	C	A	9: 38,464,642	F200L	probably benign	Het
Pcdha11	G	A	18: 37,007,373	G685D	probably benign	Het
Pgc	A	G	17: 47,732,410	I228V	probably benign	Het
Rad51	C	T	2: 119,131,568	H199Y	probably damaging	Het
Robo2	A	T	16: 74,352,519		probably benign	Het
Sap130	C	T	18: 31,711,360	T861I	probably damaging	Het
Sh3tc2	A	T	18: 62,007,773	D1061V	probably damaging	Het
Snapc3	A	G	4: 83,418,759	E119G	probably damaging	Het
Sspo	G	A	6: 48,487,225	G3862D	probably benign	Het
Tbc1d16	G	A	11: 119,157,873	T318M	possibly damaging	Het
Thrb	T	A	14: 18,011,187	W188R	probably damaging	Het
Thsd1	T	C	8: 22,243,578	Y214H	probably damaging	Het
Tnfrsf13b	T	C	11: 61,141,438	V98A	probably benign	Het
Topbp1	T	C	9: 103,344,871	Y1314H	probably damaging	Het
Ttn	C	A	2: 76,785,806	V8271L	possibly damaging	Het
Ttn	T	C	2: 76,946,913	M1382V	probably benign	Het
Utrn	G	T	10: 12,727,840	Q599K	possibly damaging	Het
Zfp995	G	A	17: 21,879,951	T434I	probably benign	Het
Zfy1	G	T	Y: 725,518	T749K	possibly damaging	Het

Other mutations in Atf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Atf6	APN	1	170788606	critical splice donor site	probably null
IGL01431:Atf6	APN	1	170853002	splice site	probably benign
IGL01755:Atf6	APN	1	170788611	missense	possibly damaging	0.63
IGL02060:Atf6	APN	1	170819420	missense	probably damaging	0.99
IGL02416:Atf6	APN	1	170747157	nonsense	probably null
IGL02903:Atf6	APN	1	170799714	missense	probably benign	0.00
IGL02989:Atf6	APN	1	170788683	splice site	probably benign
IGL03209:Atf6	APN	1	170834894	missense	probably benign
R0455:Atf6	UTSW	1	170834923	missense	probably benign	0.00
R0467:Atf6	UTSW	1	170794020	missense	probably damaging	1.00
R0491:Atf6	UTSW	1	170787344	critical splice donor site	probably null
R0784:Atf6	UTSW	1	170709947	missense	probably benign	0.19
R1486:Atf6	UTSW	1	170794691	missense	probably damaging	1.00
R1850:Atf6	UTSW	1	170819286	missense	probably damaging	1.00
R1945:Atf6	UTSW	1	170855141	missense	probably benign	0.00
R2164:Atf6	UTSW	1	170794735	missense	probably damaging	1.00
R3782:Atf6	UTSW	1	170794767	nonsense	probably null
R4631:Atf6	UTSW	1	170747197	splice site	probably null
R4676:Atf6	UTSW	1	170787410	missense	probably damaging	1.00
R5772:Atf6	UTSW	1	170747189	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841775	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841776	missense	possibly damaging	0.95
R5950:Atf6	UTSW	1	170834879	missense	probably damaging	1.00
R6242:Atf6	UTSW	1	170793976	missense	possibly damaging	0.46
R6520:Atf6	UTSW	1	170867669	missense	probably benign	0.00
R7032:Atf6	UTSW	1	170799612	critical splice donor site	probably null
R7472:Atf6	UTSW	1	170815491	missense	possibly damaging	0.83
R7923:Atf6	UTSW	1	170794706	missense	probably benign
R8002:Atf6	UTSW	1	170819254	missense	probably benign	0.43
R8860:Atf6	UTSW	1	170852966	missense	probably null	0.95
R8956:Atf6	UTSW	1	170794007	missense	probably damaging	0.98
R9090:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9271:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9323:Atf6	UTSW	1	170855113	nonsense	probably null
R9500:Atf6	UTSW	1	170747139	missense	probably damaging	0.98
R9594:Atf6	UTSW	1	170840833	missense	probably benign	0.18
R9733:Atf6	UTSW	1	170834833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCCAAATCTCCCAGGGAAG -3'
(R):5'- GGAGGTTACCTTATAACAATCCATGTC -3'

Sequencing Primer
(F):5'- TCTCCCAGGGAAGAAAGCAAGTC -3'
(R):5'- AGTCAGATATGTTGGGCTG -3'

Posted On

2015-07-21