Incidental Mutation 'R1757:Ints8'
ID273633
Institutional Source Beutler Lab
Gene Symbol Ints8
Ensembl Gene ENSMUSG00000040738
Gene Nameintegrator complex subunit 8
Synonyms2810013E07Rik, D130008D20Rik
MMRRC Submission 039789-MU
Accession Numbers

Ncbi RefSeq: NM_001159595.1, NM_178112.5; MGI:1919906

Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1757 (G1)
Quality Score38.3
Status Validated
Chromosome4
Chromosomal Location11199158-11254258 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to C at 11254109 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1 (M1R)
Ref Sequence ENSEMBL: ENSMUSP00000103955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]
Predicted Effect probably null
Transcript: ENSMUST00000044616
AA Change: M1R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: M1R

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108318
AA Change: M1R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: M1R

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108319
AA Change: M1R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: M1R

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Meta Mutation Damage Score 0.8182 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 100% (111/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 A T 14: 8,049,867 I219F probably damaging Het
Acvr1b A G 15: 101,198,822 I207V possibly damaging Het
Adamtsl4 T C 3: 95,677,942 T839A probably benign Het
Akap1 C T 11: 88,845,752 R61H probably damaging Het
Akap9 A G 5: 4,001,667 D1478G probably benign Het
Aloxe3 T A 11: 69,135,949 V547E possibly damaging Het
Ano6 G A 15: 95,962,267 A757T probably damaging Het
Armc10 A G 5: 21,653,457 T167A probably damaging Het
BB019430 A C 10: 58,704,047 noncoding transcript Het
Brms1 C T 19: 5,046,407 R82W probably damaging Het
Btnl6 G A 17: 34,514,088 T267I probably benign Het
Catsper4 A T 4: 134,217,901 F215L probably benign Het
Ccdc105 T C 10: 78,747,224 N442S probably benign Het
Ccdc188 T C 16: 18,218,688 F197S probably damaging Het
Cers5 A C 15: 99,736,331 C379G probably benign Het
Chchd6 A G 6: 89,384,644 L259P probably damaging Het
Cntnap2 T A 6: 46,759,829 C730S probably damaging Het
Coch T G 12: 51,602,848 V314G probably damaging Het
Cog1 T A 11: 113,652,304 S213T possibly damaging Het
Crot A T 5: 8,987,828 F163I probably damaging Het
Cyp4f13 A T 17: 32,929,958 I162N probably damaging Het
Dab2 A T 15: 6,330,452 probably benign Het
Depdc1b C T 13: 108,323,948 R31W probably damaging Het
Dlk1 T C 12: 109,459,687 F161S probably damaging Het
Dnah6 T C 6: 73,160,982 E913G probably damaging Het
Dnajc6 A G 4: 101,597,831 Y5C probably damaging Het
Dock10 T C 1: 80,533,869 T1508A probably damaging Het
Dstyk A G 1: 132,434,094 probably benign Het
Efcc1 T C 6: 87,749,283 probably benign Het
Entpd1 T C 19: 40,739,006 Y533H probably benign Het
Epha8 A T 4: 136,931,478 probably null Het
Erich3 C T 3: 154,695,765 T17M probably damaging Het
Ethe1 T C 7: 24,608,474 probably benign Het
Fbxw15 A T 9: 109,557,279 M211K probably damaging Het
Fhod3 G A 18: 25,066,278 V669M possibly damaging Het
Fktn C T 4: 53,747,003 probably benign Het
Foxred1 G A 9: 35,210,834 R20C probably benign Het
Gbp9 A G 5: 105,094,453 L140P probably damaging Het
Gga1 T C 15: 78,889,030 L286P probably damaging Het
Gm11397 T C 13: 33,399,353 S150P probably benign Het
Gml T C 15: 74,813,613 probably benign Het
Gsap A T 5: 21,281,037 K628N probably damaging Het
Gtf3c4 G A 2: 28,830,636 probably benign Het
H2-M10.6 A C 17: 36,813,151 Y169S probably benign Het
Hal G A 10: 93,494,628 V245I probably benign Het
Hebp2 T C 10: 18,545,101 Y72C probably damaging Het
Helz2 T C 2: 181,236,263 E914G probably damaging Het
Herc3 T C 6: 58,916,470 Y906H probably damaging Het
Hfm1 A T 5: 106,880,360 probably null Het
Hgs C T 11: 120,480,063 P582S probably damaging Het
Hoxa10 G A 6: 52,234,489 P149L probably damaging Het
Inpp5j T A 11: 3,504,738 Q4L possibly damaging Het
Isg15 T C 4: 156,199,990 E27G possibly damaging Het
Klf13 A T 7: 63,891,765 C205S probably damaging Het
Lama1 A T 17: 67,763,836 Y830F probably benign Het
Lama1 G A 17: 67,697,383 V17M unknown Het
Lama3 A G 18: 12,465,499 N988D probably benign Het
Lcat CAT C 8: 105,941,814 probably null Het
Lct G T 1: 128,301,257 P833H probably damaging Het
Lmf1 A T 17: 25,655,210 R403W probably damaging Het
Me3 T G 7: 89,633,022 S38A probably benign Het
Myg1 A T 15: 102,331,829 D30V probably benign Het
Nbea A G 3: 55,630,189 I2841T possibly damaging Het
Nek1 T A 8: 61,089,813 probably null Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr1158 T G 2: 87,990,582 I157R probably damaging Het
Olfr1198 G T 2: 88,746,017 D290E probably benign Het
Olfr1475 A C 19: 13,479,607 V197G possibly damaging Het
Olfr430 A T 1: 174,069,658 Y120F probably damaging Het
Osbpl9 A G 4: 109,064,583 Y613H probably damaging Het
Per3 C T 4: 151,042,792 probably null Het
Pex6 G T 17: 46,723,498 V758L probably damaging Het
Pikfyve A G 1: 65,252,548 I1309V probably damaging Het
Pimreg A G 11: 72,043,159 E37G possibly damaging Het
Pjvk G A 2: 76,655,888 V211I probably benign Het
Plekhg4 T A 8: 105,381,661 V1112E probably damaging Het
Ptprz1 T A 6: 23,044,320 M2106K probably damaging Het
Rdh16f2 G T 10: 127,876,896 L254F probably benign Het
Rictor G A 15: 6,773,862 R485Q possibly damaging Het
Rnf146 G A 10: 29,347,479 T137M probably damaging Het
Rrp9 T A 9: 106,483,004 C204S probably damaging Het
Shkbp1 T C 7: 27,342,351 T693A probably benign Het
Skint9 A G 4: 112,413,962 Y84H probably benign Het
Slc22a12 A T 19: 6,536,731 probably null Het
Slfn4 T C 11: 83,185,385 C26R possibly damaging Het
Snrnp200 T C 2: 127,232,443 L1401P probably damaging Het
Specc1 T A 11: 62,119,284 probably null Het
Spef2 A T 15: 9,717,482 M316K probably damaging Het
Tbc1d22b A G 17: 29,571,673 R204G probably damaging Het
Tgfbr3l C A 8: 4,249,548 D110E probably benign Het
Ticrr T G 7: 79,675,323 S532R probably damaging Het
Ticrr C A 7: 79,679,046 Y644* probably null Het
Tmem5 T C 10: 122,089,015 T261A probably benign Het
Traf3ip1 A T 1: 91,522,857 T509S probably damaging Het
Trmt10b T C 4: 45,307,946 Y209H probably damaging Het
Trmt6 T C 2: 132,810,237 M172V probably damaging Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Tshz2 C A 2: 169,883,923 F146L probably benign Het
Tspyl4 G T 10: 34,297,580 E23* probably null Het
Ulk2 A T 11: 61,841,339 probably benign Het
Umodl1 A T 17: 31,008,700 I1336F probably damaging Het
Vezt T C 10: 93,970,563 D662G probably benign Het
Vnn1 A T 10: 23,900,828 Q359L possibly damaging Het
Vnn1 G T 10: 23,900,829 Q359H probably benign Het
Zdhhc16 A G 19: 41,941,955 N14S probably damaging Het
Zfp455 T C 13: 67,207,537 S225P probably damaging Het
Zfp74 T A 7: 29,935,061 E407D probably benign Het
Zic2 T A 14: 122,478,619 H384Q possibly damaging Het
Other mutations in Ints8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Ints8 APN 4 11218679 splice site probably benign
IGL01925:Ints8 APN 4 11235617 splice site probably benign
IGL02195:Ints8 APN 4 11221222 missense probably damaging 1.00
IGL02215:Ints8 APN 4 11209244 missense probably damaging 1.00
IGL02429:Ints8 APN 4 11231720 missense probably damaging 1.00
IGL02484:Ints8 APN 4 11208834 nonsense probably null
IGL02558:Ints8 APN 4 11218771 missense probably damaging 1.00
IGL02725:Ints8 APN 4 11239406 missense probably benign 0.01
IGL02742:Ints8 APN 4 11241627 missense possibly damaging 0.75
IGL02831:Ints8 APN 4 11245896 missense possibly damaging 0.51
IGL03140:Ints8 APN 4 11235565 missense probably damaging 1.00
IGL03171:Ints8 APN 4 11231702 missense probably benign 0.01
IGL03335:Ints8 APN 4 11216460 missense probably damaging 1.00
G1Funyon:Ints8 UTSW 4 11246120 missense probably damaging 1.00
P0026:Ints8 UTSW 4 11225788 nonsense probably null
R0054:Ints8 UTSW 4 11204595 utr 3 prime probably benign
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0184:Ints8 UTSW 4 11218637 missense probably benign 0.03
R0299:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0499:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0540:Ints8 UTSW 4 11252926 missense possibly damaging 0.94
R0657:Ints8 UTSW 4 11246097 missense probably benign 0.04
R1232:Ints8 UTSW 4 11234587 missense possibly damaging 0.81
R1296:Ints8 UTSW 4 11221204 missense possibly damaging 0.95
R1390:Ints8 UTSW 4 11239461 missense probably benign 0.22
R1503:Ints8 UTSW 4 11245842 missense probably damaging 0.97
R1587:Ints8 UTSW 4 11245722 critical splice donor site probably null
R1701:Ints8 UTSW 4 11231656 missense probably damaging 1.00
R1721:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1777:Ints8 UTSW 4 11225600 critical splice donor site probably null
R1867:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1868:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1952:Ints8 UTSW 4 11221150 missense probably benign 0.21
R2084:Ints8 UTSW 4 11230377 missense probably benign 0.31
R2108:Ints8 UTSW 4 11235552 missense probably damaging 0.99
R2202:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2203:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2205:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2439:Ints8 UTSW 4 11225725 missense probably benign 0.29
R2504:Ints8 UTSW 4 11241642 missense probably benign 0.03
R3824:Ints8 UTSW 4 11225621 nonsense probably null
R4664:Ints8 UTSW 4 11227152 missense probably benign 0.04
R4703:Ints8 UTSW 4 11223785 missense possibly damaging 0.92
R4895:Ints8 UTSW 4 11230367 nonsense probably null
R5206:Ints8 UTSW 4 11216477 missense possibly damaging 0.65
R5262:Ints8 UTSW 4 11211916 missense probably damaging 1.00
R5505:Ints8 UTSW 4 11221143 missense probably benign 0.18
R5513:Ints8 UTSW 4 11248303 missense possibly damaging 0.79
R5750:Ints8 UTSW 4 11241654 missense possibly damaging 0.81
R5892:Ints8 UTSW 4 11223813 missense probably damaging 1.00
R6007:Ints8 UTSW 4 11208845 missense possibly damaging 0.70
R6229:Ints8 UTSW 4 11252891 missense probably damaging 1.00
R6466:Ints8 UTSW 4 11252878 missense probably damaging 0.99
R6709:Ints8 UTSW 4 11221117 missense possibly damaging 0.65
R6986:Ints8 UTSW 4 11204474 missense probably damaging 1.00
R6998:Ints8 UTSW 4 11204537 missense possibly damaging 0.80
R7074:Ints8 UTSW 4 11204574 missense possibly damaging 0.82
R7221:Ints8 UTSW 4 11225613 missense probably benign 0.01
R7772:Ints8 UTSW 4 11227190 missense probably damaging 0.97
R7872:Ints8 UTSW 4 11254062 missense probably benign 0.00
R7953:Ints8 UTSW 4 11227128 missense probably benign
R8184:Ints8 UTSW 4 11204534 missense probably damaging 1.00
R8301:Ints8 UTSW 4 11246120 missense probably damaging 1.00
R8708:Ints8 UTSW 4 11208824 critical splice donor site probably null
R8868:Ints8 UTSW 4 11230488 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAAACTTTCCGCAGACGCTCC -3'
(R):5'- CGCCAGAATCTAGCTTCTGAAGGG -3'

Sequencing Primer
(F):5'- GCTGAGGCACCGTCGAG -3'
(R):5'- CCTCCGAAGTCTAACTGGGATTG -3'
Posted On2015-03-31