Mutagenetix > Incidental Mutation

Incidental Mutation 'R1757:Lama3'

195029

Institutional Source

Beutler Lab

Gene Symbol

Lama3

Ensembl Gene

ENSMUSG00000024421

Gene Name

laminin, alpha 3

Synonyms

[a]3B, nicein, 150kDa

MMRRC Submission

039789-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1757 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12333819-12583013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12465499 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 988 (N988D)

Ref Sequence

ENSEMBL: ENSMUSP00000089703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092070]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000092070
AA Change: N988D

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: N988D

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
LamNT	38	294	1.46e-153	SMART
EGF_Lam	296	350	1.39e-4	SMART
EGF_Lam	353	420	2.66e-10	SMART
EGF_Lam	423	464	3.51e-10	SMART
EGF_Lam	488	530	1.73e-9	SMART
EGF_Lam	533	576	3.81e-11	SMART
EGF_like	579	625	1.82e-1	SMART
EGF_Lam	628	678	5.15e-8	SMART
EGF_Lam	681	725	3.54e-6	SMART
low complexity region	768	781	N/A	INTRINSIC
EGF_Lam	1263	1306	3.15e-12	SMART
EGF_Lam	1309	1350	6.3e-3	SMART
EGF_Lam	1353	1399	1.49e-13	SMART
EGF_Lam	1402	1450	8.18e-11	SMART
LamB	1509	1638	4.34e-55	SMART
Pfam:Laminin_EGF	1647	1681	7.9e-5	PFAM
EGF_Lam	1684	1728	2.66e-10	SMART
EGF_Lam	1731	1781	7.81e-8	SMART
Pfam:Laminin_I	1836	2102	2.7e-93	PFAM
low complexity region	2185	2200	N/A	INTRINSIC
coiled coil region	2211	2238	N/A	INTRINSIC
LamG	2406	2566	1.67e-2	SMART
LamG	2614	2742	1.72e-17	SMART
LamG	2785	2900	3.96e-17	SMART
LamG	3005	3133	1.12e-34	SMART
LamG	3175	3308	3.41e-30	SMART

Meta Mutation Damage Score

0.0773

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

100% (111/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd6	A	T	14: 8,049,867	I219F	probably damaging	Het
Acvr1b	A	G	15: 101,198,822	I207V	possibly damaging	Het
Adamtsl4	T	C	3: 95,677,942	T839A	probably benign	Het
Akap1	C	T	11: 88,845,752	R61H	probably damaging	Het
Akap9	A	G	5: 4,001,667	D1478G	probably benign	Het
Aloxe3	T	A	11: 69,135,949	V547E	possibly damaging	Het
Ano6	G	A	15: 95,962,267	A757T	probably damaging	Het
Armc10	A	G	5: 21,653,457	T167A	probably damaging	Het
BB019430	A	C	10: 58,704,047		noncoding transcript	Het
Brms1	C	T	19: 5,046,407	R82W	probably damaging	Het
Btnl6	G	A	17: 34,514,088	T267I	probably benign	Het
Catsper4	A	T	4: 134,217,901	F215L	probably benign	Het
Ccdc105	T	C	10: 78,747,224	N442S	probably benign	Het
Ccdc188	T	C	16: 18,218,688	F197S	probably damaging	Het
Cers5	A	C	15: 99,736,331	C379G	probably benign	Het
Chchd6	A	G	6: 89,384,644	L259P	probably damaging	Het
Cntnap2	T	A	6: 46,759,829	C730S	probably damaging	Het
Coch	T	G	12: 51,602,848	V314G	probably damaging	Het
Cog1	T	A	11: 113,652,304	S213T	possibly damaging	Het
Crot	A	T	5: 8,987,828	F163I	probably damaging	Het
Cyp4f13	A	T	17: 32,929,958	I162N	probably damaging	Het
Dab2	A	T	15: 6,330,452		probably benign	Het
Depdc1b	C	T	13: 108,323,948	R31W	probably damaging	Het
Dlk1	T	C	12: 109,459,687	F161S	probably damaging	Het
Dnah6	T	C	6: 73,160,982	E913G	probably damaging	Het
Dnajc6	A	G	4: 101,597,831	Y5C	probably damaging	Het
Dock10	T	C	1: 80,533,869	T1508A	probably damaging	Het
Dstyk	A	G	1: 132,434,094		probably benign	Het
Efcc1	T	C	6: 87,749,283		probably benign	Het
Entpd1	T	C	19: 40,739,006	Y533H	probably benign	Het
Epha8	A	T	4: 136,931,478		probably null	Het
Erich3	C	T	3: 154,695,765	T17M	probably damaging	Het
Ethe1	T	C	7: 24,608,474		probably benign	Het
Fbxw15	A	T	9: 109,557,279	M211K	probably damaging	Het
Fhod3	G	A	18: 25,066,278	V669M	possibly damaging	Het
Fktn	C	T	4: 53,747,003		probably benign	Het
Foxred1	G	A	9: 35,210,834	R20C	probably benign	Het
Gbp9	A	G	5: 105,094,453	L140P	probably damaging	Het
Gga1	T	C	15: 78,889,030	L286P	probably damaging	Het
Gm11397	T	C	13: 33,399,353	S150P	probably benign	Het
Gml	T	C	15: 74,813,613		probably benign	Het
Gsap	A	T	5: 21,281,037	K628N	probably damaging	Het
Gtf3c4	G	A	2: 28,830,636		probably benign	Het
H2-M10.6	A	C	17: 36,813,151	Y169S	probably benign	Het
Hal	G	A	10: 93,494,628	V245I	probably benign	Het
Hebp2	T	C	10: 18,545,101	Y72C	probably damaging	Het
Helz2	T	C	2: 181,236,263	E914G	probably damaging	Het
Herc3	T	C	6: 58,916,470	Y906H	probably damaging	Het
Hfm1	A	T	5: 106,880,360		probably null	Het
Hgs	C	T	11: 120,480,063	P582S	probably damaging	Het
Hoxa10	G	A	6: 52,234,489	P149L	probably damaging	Het
Inpp5j	T	A	11: 3,504,738	Q4L	possibly damaging	Het
Ints8	A	C	4: 11,254,109	M1R	probably null	Het
Isg15	T	C	4: 156,199,990	E27G	possibly damaging	Het
Klf13	A	T	7: 63,891,765	C205S	probably damaging	Het
Lama1	G	A	17: 67,697,383	V17M	unknown	Het
Lama1	A	T	17: 67,763,836	Y830F	probably benign	Het
Lcat	CAT	C	8: 105,941,814		probably null	Het
Lct	G	T	1: 128,301,257	P833H	probably damaging	Het
Lmf1	A	T	17: 25,655,210	R403W	probably damaging	Het
Me3	T	G	7: 89,633,022	S38A	probably benign	Het
Myg1	A	T	15: 102,331,829	D30V	probably benign	Het
Nbea	A	G	3: 55,630,189	I2841T	possibly damaging	Het
Nek1	T	A	8: 61,089,813		probably null	Het
Obsl1	C	T	1: 75,493,883	R1043H	probably benign	Het
Olfr1158	T	G	2: 87,990,582	I157R	probably damaging	Het
Olfr1198	G	T	2: 88,746,017	D290E	probably benign	Het
Olfr1475	A	C	19: 13,479,607	V197G	possibly damaging	Het
Olfr430	A	T	1: 174,069,658	Y120F	probably damaging	Het
Osbpl9	A	G	4: 109,064,583	Y613H	probably damaging	Het
Per3	C	T	4: 151,042,792		probably null	Het
Pex6	G	T	17: 46,723,498	V758L	probably damaging	Het
Pikfyve	A	G	1: 65,252,548	I1309V	probably damaging	Het
Pimreg	A	G	11: 72,043,159	E37G	possibly damaging	Het
Pjvk	G	A	2: 76,655,888	V211I	probably benign	Het
Plekhg4	T	A	8: 105,381,661	V1112E	probably damaging	Het
Ptprz1	T	A	6: 23,044,320	M2106K	probably damaging	Het
Rdh16f2	G	T	10: 127,876,896	L254F	probably benign	Het
Rictor	G	A	15: 6,773,862	R485Q	possibly damaging	Het
Rnf146	G	A	10: 29,347,479	T137M	probably damaging	Het
Rrp9	T	A	9: 106,483,004	C204S	probably damaging	Het
Shkbp1	T	C	7: 27,342,351	T693A	probably benign	Het
Skint9	A	G	4: 112,413,962	Y84H	probably benign	Het
Slc22a12	A	T	19: 6,536,731		probably null	Het
Slfn4	T	C	11: 83,185,385	C26R	possibly damaging	Het
Snrnp200	T	C	2: 127,232,443	L1401P	probably damaging	Het
Specc1	T	A	11: 62,119,284		probably null	Het
Spef2	A	T	15: 9,717,482	M316K	probably damaging	Het
Tbc1d22b	A	G	17: 29,571,673	R204G	probably damaging	Het
Tgfbr3l	C	A	8: 4,249,548	D110E	probably benign	Het
Ticrr	T	G	7: 79,675,323	S532R	probably damaging	Het
Ticrr	C	A	7: 79,679,046	Y644*	probably null	Het
Tmem5	T	C	10: 122,089,015	T261A	probably benign	Het
Traf3ip1	A	T	1: 91,522,857	T509S	probably damaging	Het
Trmt10b	T	C	4: 45,307,946	Y209H	probably damaging	Het
Trmt6	T	C	2: 132,810,237	M172V	probably damaging	Het
Tsc1	A	G	2: 28,686,113	D978G	probably benign	Het
Tshz2	C	A	2: 169,883,923	F146L	probably benign	Het
Tspyl4	G	T	10: 34,297,580	E23*	probably null	Het
Ulk2	A	T	11: 61,841,339		probably benign	Het
Umodl1	A	T	17: 31,008,700	I1336F	probably damaging	Het
Vezt	T	C	10: 93,970,563	D662G	probably benign	Het
Vnn1	A	T	10: 23,900,828	Q359L	possibly damaging	Het
Vnn1	G	T	10: 23,900,829	Q359H	probably benign	Het
Zdhhc16	A	G	19: 41,941,955	N14S	probably damaging	Het
Zfp455	T	C	13: 67,207,537	S225P	probably damaging	Het
Zfp74	T	A	7: 29,935,061	E407D	probably benign	Het
Zic2	T	A	14: 122,478,619	H384Q	possibly damaging	Het

Other mutations in Lama3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Lama3	APN	18	12580292	missense	probably benign
IGL00272:Lama3	APN	18	12491548	missense	probably damaging	1.00
IGL00335:Lama3	APN	18	12449588	splice site	probably benign
IGL00836:Lama3	APN	18	12472228	missense	probably benign	0.01
IGL01017:Lama3	APN	18	12441143	critical splice donor site	probably null
IGL01025:Lama3	APN	18	12481037	missense	probably benign	0.09
IGL01394:Lama3	APN	18	12531926	missense	probably null	0.39
IGL01545:Lama3	APN	18	12441131	missense	probably benign	0.01
IGL01685:Lama3	APN	18	12453880	splice site	probably benign
IGL01863:Lama3	APN	18	12419936	splice site	probably benign
IGL01869:Lama3	APN	18	12524763	missense	possibly damaging	0.94
IGL01894:Lama3	APN	18	12572064	missense	probably benign	0.09
IGL02027:Lama3	APN	18	12516513	missense	probably damaging	1.00
IGL02106:Lama3	APN	18	12468314	missense	probably damaging	0.98
IGL02307:Lama3	APN	18	12581783	missense	probably benign	0.09
IGL02342:Lama3	APN	18	12491476	missense	probably damaging	1.00
IGL02377:Lama3	APN	18	12556750	missense	possibly damaging	0.49
IGL02401:Lama3	APN	18	12557727	missense	probably benign	0.02
IGL02517:Lama3	APN	18	12537858	critical splice donor site	probably null
IGL02644:Lama3	APN	18	12525853	missense	probably benign	0.12
IGL02733:Lama3	APN	18	12578127	missense	probably damaging	0.99
IGL02932:Lama3	APN	18	12528801	missense	probably damaging	1.00
IGL03006:Lama3	APN	18	12468368	splice site	probably benign
IGL03038:Lama3	APN	18	12419250	missense	probably damaging	0.99
IGL03064:Lama3	APN	18	12439349	missense	possibly damaging	0.72
IGL03146:Lama3	APN	18	12527624	missense	possibly damaging	0.66
IGL03233:Lama3	APN	18	12481038	missense	probably damaging	1.00
IGL03255:Lama3	APN	18	12539703	missense	probably damaging	1.00
IGL03369:Lama3	APN	18	12553283	missense	probably benign	0.05
IGL03412:Lama3	APN	18	12419182	missense	probably damaging	0.99
IGL02980:Lama3	UTSW	18	12553231	missense	probably benign	0.01
IGL03014:Lama3	UTSW	18	12539967	missense	possibly damaging	0.95
R0007:Lama3	UTSW	18	12497881	splice site	probably benign
R0007:Lama3	UTSW	18	12497881	splice site	probably benign
R0050:Lama3	UTSW	18	12404103	missense	probably damaging	1.00
R0050:Lama3	UTSW	18	12404103	missense	probably damaging	1.00
R0063:Lama3	UTSW	18	12528705	splice site	probably benign
R0063:Lama3	UTSW	18	12528705	splice site	probably benign
R0106:Lama3	UTSW	18	12403982	missense	probably damaging	0.96
R0148:Lama3	UTSW	18	12448272	missense	probably damaging	1.00
R0165:Lama3	UTSW	18	12524810	missense	probably damaging	0.99
R0240:Lama3	UTSW	18	12539823	splice site	probably null
R0240:Lama3	UTSW	18	12539823	splice site	probably null
R0316:Lama3	UTSW	18	12519877	missense	probably benign	0.09
R0325:Lama3	UTSW	18	12482126	missense	probably damaging	1.00
R0365:Lama3	UTSW	18	12507007	missense	probably damaging	0.96
R0390:Lama3	UTSW	18	12407563	missense	probably benign	0.10
R0408:Lama3	UTSW	18	12456837	missense	probably benign
R0449:Lama3	UTSW	18	12500512	splice site	probably null
R0453:Lama3	UTSW	18	12465478	missense	possibly damaging	0.63
R0480:Lama3	UTSW	18	12450424	missense	possibly damaging	0.81
R0536:Lama3	UTSW	18	12525894	missense	probably damaging	1.00
R0545:Lama3	UTSW	18	12561701	missense	possibly damaging	0.90
R0567:Lama3	UTSW	18	12549252	missense	probably benign
R0605:Lama3	UTSW	18	12506949	missense	probably benign	0.02
R0617:Lama3	UTSW	18	12419258	critical splice donor site	probably null
R0629:Lama3	UTSW	18	12419245	missense	possibly damaging	0.79
R0671:Lama3	UTSW	18	12477590	missense	possibly damaging	0.80
R0730:Lama3	UTSW	18	12456850	splice site	probably benign
R1216:Lama3	UTSW	18	12421134	splice site	probably benign
R1356:Lama3	UTSW	18	12500577	unclassified	probably benign
R1386:Lama3	UTSW	18	12477370	missense	probably benign	0.04
R1424:Lama3	UTSW	18	12519991	missense	probably benign	0.13
R1426:Lama3	UTSW	18	12481098	critical splice donor site	probably null
R1437:Lama3	UTSW	18	12549227	missense	possibly damaging	0.46
R1468:Lama3	UTSW	18	12441107	missense	probably benign	0.00
R1468:Lama3	UTSW	18	12441107	missense	probably benign	0.00
R1472:Lama3	UTSW	18	12482045	missense	probably benign	0.23
R1557:Lama3	UTSW	18	12513731	splice site	probably benign
R1571:Lama3	UTSW	18	12539717	missense	probably damaging	0.98
R1599:Lama3	UTSW	18	12450400	nonsense	probably null
R1631:Lama3	UTSW	18	12407494	missense	probably damaging	1.00
R1647:Lama3	UTSW	18	12532199	missense	possibly damaging	0.90
R1648:Lama3	UTSW	18	12532199	missense	possibly damaging	0.90
R1719:Lama3	UTSW	18	12479872	critical splice donor site	probably null
R1766:Lama3	UTSW	18	12402062	missense	probably damaging	1.00
R1853:Lama3	UTSW	18	12513705	missense	possibly damaging	0.75
R1856:Lama3	UTSW	18	12537781	nonsense	probably null
R1909:Lama3	UTSW	18	12581798	missense	probably benign	0.19
R1913:Lama3	UTSW	18	12495279	missense	probably benign	0.15
R1975:Lama3	UTSW	18	12453863	missense	probably damaging	1.00
R2014:Lama3	UTSW	18	12524721	splice site	probably benign
R2059:Lama3	UTSW	18	12528333	missense	probably damaging	0.98
R2060:Lama3	UTSW	18	12528726	missense	probably benign	0.30
R2086:Lama3	UTSW	18	12524830	missense	probably benign	0.39
R2115:Lama3	UTSW	18	12402849	missense	possibly damaging	0.94
R2291:Lama3	UTSW	18	12525079	missense	probably damaging	0.98
R2860:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R2861:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R2862:Lama3	UTSW	18	12453750	missense	probably damaging	1.00
R3410:Lama3	UTSW	18	12413858	critical splice donor site	probably null
R3614:Lama3	UTSW	18	12448288	missense	probably benign	0.03
R3696:Lama3	UTSW	18	12439475	splice site	probably benign
R3752:Lama3	UTSW	18	12507029	missense	probably damaging	1.00
R3967:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3968:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3969:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R3970:Lama3	UTSW	18	12580341	missense	probably damaging	1.00
R4088:Lama3	UTSW	18	12504308	nonsense	probably null
R4118:Lama3	UTSW	18	12450431	missense	probably benign	0.01
R4222:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4223:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4224:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4225:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R4367:Lama3	UTSW	18	12513690	missense	probably damaging	1.00
R4404:Lama3	UTSW	18	12582531	missense	probably benign	0.01
R4424:Lama3	UTSW	18	12519872	nonsense	probably null
R4483:Lama3	UTSW	18	12549253	missense	probably benign	0.32
R4484:Lama3	UTSW	18	12481088	missense	probably benign
R4516:Lama3	UTSW	18	12495358	missense	probably damaging	1.00
R4556:Lama3	UTSW	18	12479759	missense	possibly damaging	0.63
R4616:Lama3	UTSW	18	12504397	critical splice donor site	probably null
R4702:Lama3	UTSW	18	12578029	nonsense	probably null
R4704:Lama3	UTSW	18	12553223	missense	probably benign	0.08
R4750:Lama3	UTSW	18	12504359	missense	probably benign	0.25
R4753:Lama3	UTSW	18	12482084	missense	probably damaging	1.00
R4767:Lama3	UTSW	18	12500563	missense	probably benign	0.32
R4777:Lama3	UTSW	18	12413771	missense	probably damaging	1.00
R4782:Lama3	UTSW	18	12411570	nonsense	probably null
R4784:Lama3	UTSW	18	12449544	missense	probably benign	0.20
R4816:Lama3	UTSW	18	12477604	missense	possibly damaging	0.93
R4833:Lama3	UTSW	18	12441131	missense	probably benign	0.01
R4854:Lama3	UTSW	18	12411542	missense	probably benign	0.00
R4863:Lama3	UTSW	18	12498678	intron	probably benign
R4863:Lama3	UTSW	18	12539793	missense	probably damaging	0.99
R4953:Lama3	UTSW	18	12448305	missense	probably damaging	1.00
R4974:Lama3	UTSW	18	12552826	missense	probably damaging	0.98
R4996:Lama3	UTSW	18	12518743	missense	probably benign	0.24
R5049:Lama3	UTSW	18	12582611	missense	probably benign	0.19
R5057:Lama3	UTSW	18	12531948	missense	probably null	0.82
R5090:Lama3	UTSW	18	12542402	missense	possibly damaging	0.94
R5122:Lama3	UTSW	18	12539766	missense	possibly damaging	0.53
R5215:Lama3	UTSW	18	12577900	missense	probably damaging	1.00
R5245:Lama3	UTSW	18	12419893	missense	probably damaging	1.00
R5259:Lama3	UTSW	18	12465508	missense	probably damaging	1.00
R5320:Lama3	UTSW	18	12552855	missense	probably damaging	0.99
R5377:Lama3	UTSW	18	12453746	missense	probably damaging	0.99
R5432:Lama3	UTSW	18	12572066	missense	probably damaging	1.00
R5500:Lama3	UTSW	18	12456764	missense	possibly damaging	0.93
R5534:Lama3	UTSW	18	12553210	missense	probably benign	0.00
R5589:Lama3	UTSW	18	12472220	missense	possibly damaging	0.46
R5604:Lama3	UTSW	18	12439348	missense	probably benign
R5617:Lama3	UTSW	18	12498936	intron	probably benign
R5709:Lama3	UTSW	18	12539799	missense	probably damaging	1.00
R5965:Lama3	UTSW	18	12429887	missense	possibly damaging	0.67
R6042:Lama3	UTSW	18	12574254	missense	probably damaging	1.00
R6065:Lama3	UTSW	18	12469928	missense	possibly damaging	0.53
R6085:Lama3	UTSW	18	12482099	missense	probably benign	0.01
R6212:Lama3	UTSW	18	12513645	missense	probably damaging	1.00
R6268:Lama3	UTSW	18	12524737	missense	probably damaging	0.98
R6276:Lama3	UTSW	18	12506949	missense	probably benign	0.02
R6366:Lama3	UTSW	18	12482137	missense	probably damaging	1.00
R6393:Lama3	UTSW	18	12479756	missense	probably benign	0.44
R6493:Lama3	UTSW	18	12482148	critical splice donor site	probably null
R6505:Lama3	UTSW	18	12495348	missense	probably benign	0.02
R6563:Lama3	UTSW	18	12537766	missense	probably damaging	1.00
R6582:Lama3	UTSW	18	12577840	missense	probably damaging	1.00
R6585:Lama3	UTSW	18	12419257	critical splice donor site	probably null
R6609:Lama3	UTSW	18	12513678	missense	probably damaging	0.99
R6656:Lama3	UTSW	18	12549226	missense	possibly damaging	0.66
R6833:Lama3	UTSW	18	12491548	missense	probably damaging	1.00
R6834:Lama3	UTSW	18	12491548	missense	probably damaging	1.00
R7019:Lama3	UTSW	18	12528418	missense	probably damaging	0.97
R7026:Lama3	UTSW	18	12516548	missense	probably damaging	0.98
R7088:Lama3	UTSW	18	12582545	missense	possibly damaging	0.90
R7100:Lama3	UTSW	18	12582644	missense	possibly damaging	0.80
R7102:Lama3	UTSW	18	12552813	missense	possibly damaging	0.66
R7103:Lama3	UTSW	18	12531879	missense	probably benign	0.00
R7121:Lama3	UTSW	18	12462782	missense	probably benign	0.06
R7133:Lama3	UTSW	18	12539786	missense	probably benign	0.05
R7150:Lama3	UTSW	18	12468289	missense	probably damaging	1.00
R7158:Lama3	UTSW	18	12456812	missense	probably benign	0.20
R7170:Lama3	UTSW	18	12404076	missense	probably benign	0.26
R7216:Lama3	UTSW	18	12430000	missense	probably damaging	1.00
R7223:Lama3	UTSW	18	12582608	missense	possibly damaging	0.53
R7243:Lama3	UTSW	18	12419845	missense	probably damaging	1.00
R7282:Lama3	UTSW	18	12439392	missense	probably damaging	0.99
R7337:Lama3	UTSW	18	12507040	splice site	probably null
R7442:Lama3	UTSW	18	12472181	critical splice acceptor site	probably null
R7487:Lama3	UTSW	18	12419237	missense	probably benign
R7604:Lama3	UTSW	18	12500493	missense	possibly damaging	0.93
R7609:Lama3	UTSW	18	12531834	critical splice acceptor site	probably null
R7650:Lama3	UTSW	18	12537838	missense	probably benign	0.01
R7894:Lama3	UTSW	18	12462807	missense	probably benign	0.07
R7975:Lama3	UTSW	18	12537739	missense	probably damaging	1.00
R8099:Lama3	UTSW	18	12534063	missense	probably damaging	0.97
R8168:Lama3	UTSW	18	12506942	missense	probably null
R8219:Lama3	UTSW	18	12439360	missense	probably benign	0.07
R8227:Lama3	UTSW	18	12407551	missense	probably benign
R8229:Lama3	UTSW	18	12407551	missense	probably benign
R8298:Lama3	UTSW	18	12525853	missense	probably benign	0.12
R8351:Lama3	UTSW	18	12540613	missense	probably damaging	1.00
R8364:Lama3	UTSW	18	12528347	missense	probably damaging	0.99
R8463:Lama3	UTSW	18	12449839	missense	probably damaging	0.96
R8515:Lama3	UTSW	18	12411631	missense	probably null	0.01
R8784:Lama3	UTSW	18	12421155	missense	probably benign
R8799:Lama3	UTSW	18	12490943	missense	probably damaging	0.96
R8874:Lama3	UTSW	18	12449586	critical splice donor site	probably null
R8938:Lama3	UTSW	18	12556705	missense	probably damaging	1.00
R8967:Lama3	UTSW	18	12532039	missense	possibly damaging	0.46
R9039:Lama3	UTSW	18	12481063	nonsense	probably null
R9126:Lama3	UTSW	18	12450470	missense	probably damaging	1.00
R9200:Lama3	UTSW	18	12472240	missense	probably benign	0.00
R9203:Lama3	UTSW	18	12462812	missense	probably benign	0.04
R9246:Lama3	UTSW	18	12577902	missense	probably damaging	0.99
R9284:Lama3	UTSW	18	12450484	nonsense	probably null
R9553:Lama3	UTSW	18	12429962	missense	probably damaging	1.00
R9716:Lama3	UTSW	18	12450403	missense	probably damaging	1.00
R9734:Lama3	UTSW	18	12549263	missense	possibly damaging	0.94
X0019:Lama3	UTSW	18	12582574	missense	possibly damaging	0.94
Z1177:Lama3	UTSW	18	12429879	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTCCTCTCTGGCAGGTAGAACTG -3'
(R):5'- AGTAAGCCCTTGGCAATTAGCACTC -3'

Sequencing Primer
(F):5'- TGGTGGACGTGAATCTGAAG -3'
(R):5'- GCACTCTTGGGCAAAAAGTTC -3'

Posted On

2014-05-23