Mutagenetix > Incidental Mutation

Incidental Mutation 'R0685:Tinag'

61129

Institutional Source

Beutler Lab

Gene Symbol

Tinag

Ensembl Gene

ENSMUSG00000032357

Gene Name

tubulointerstitial nephritis antigen

Synonyms

TIN-ag

MMRRC Submission

038870-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R0685 (G1)

Quality Score

196

Status

Validated

Chromosome

Chromosomal Location

76951693-77045794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 76952003 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 441 (W441L)

Ref Sequence

ENSEMBL: ENSMUSP00000034911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]

AlphaFold

Q9WUR0

Predicted Effect

probably damaging
Transcript: ENSMUST00000034911
AA Change: W441L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: W441L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART
Pept_C1	216	466	1.83e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184897

SMART Domains

Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART

Meta Mutation Damage Score

0.8900

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 95.6%

Validation Efficiency

98% (89/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	A	G	10: 21,593,438	D17G	probably damaging	Het
Abi3bp	A	G	16: 56,532,953	T82A	possibly damaging	Het
Adgre4	A	C	17: 55,792,035	E180D	probably benign	Het
Ankrd28	G	A	14: 31,743,450		probably benign	Het
Aoc3	A	G	11: 101,336,447	D382G	possibly damaging	Het
Apob	C	A	12: 8,010,742	R3075S	probably benign	Het
Aqr	A	G	2: 114,140,977	F459S	probably damaging	Het
Bcr	T	C	10: 75,131,643	W570R	probably damaging	Het
Bloc1s5	C	T	13: 38,603,919	R163K	probably benign	Het
Bod1	A	T	11: 31,669,267	N101K	possibly damaging	Het
Bysl	A	T	17: 47,602,471	S296T	probably benign	Het
Chl1	G	A	6: 103,708,542		probably null	Het
Clstn1	G	A	4: 149,646,855	A885T	probably benign	Het
Cyp3a25	G	T	5: 145,998,546	P87T	probably damaging	Het
Dync1h1	T	C	12: 110,657,192	V3633A	probably damaging	Het
Elp4	C	A	2: 105,792,277	C241F	possibly damaging	Het
Fat4	T	A	3: 39,001,178	F4182Y	probably benign	Het
Gabbr2	G	A	4: 46,787,521	H381Y	possibly damaging	Het
Gm10577	G	T	4: 101,020,318		probably benign	Het
Gm884	T	C	11: 103,616,888		probably benign	Het
Gm9955	G	T	18: 24,709,257		probably benign	Het
Gstm5	T	A	3: 107,897,319	I73N	probably damaging	Het
Gypa	T	A	8: 80,496,702		probably benign	Het
Hectd2	T	A	19: 36,569,431	V64D	probably damaging	Het
Igkv10-95	T	A	6: 68,680,559	Y20N	probably benign	Het
Il15	T	C	8: 82,337,559		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kiz	C	A	2: 146,856,058		probably benign	Het
Lcmt2	C	A	2: 121,139,240	S234I	probably benign	Het
Lilra5	A	G	7: 4,241,957		probably benign	Het
Lin37	T	C	7: 30,555,874	E187G	probably damaging	Het
Mcmdc2	T	A	1: 9,911,814		probably null	Het
Mctp1	T	C	13: 76,825,799		probably null	Het
Mdp1	C	A	14: 55,659,269	G112*	probably null	Het
Mmp15	T	C	8: 95,372,134	Y530H	possibly damaging	Het
Mtss1l	T	C	8: 110,727,397		probably null	Het
Muc5ac	T	C	7: 141,807,709	S1586P	probably benign	Het
Nap1l5	A	T	6: 58,906,772	C66S	possibly damaging	Het
Ninl	G	T	2: 150,939,855	Q1237K	possibly damaging	Het
Olfr1160	T	C	2: 88,006,418	E111G	probably damaging	Het
Olfr495	A	T	7: 108,395,263	T48S	possibly damaging	Het
Orc6	T	G	8: 85,301,154	S37R	possibly damaging	Het
Papss1	A	C	3: 131,583,093	N119H	possibly damaging	Het
Phf13	A	T	4: 151,991,612	F278I	probably damaging	Het
Pole2	C	A	12: 69,211,413	A239S	probably damaging	Het
Ppt2	T	C	17: 34,626,572	D75G	probably damaging	Het
Psd2	A	G	18: 36,002,991	D443G	possibly damaging	Het
Psen1	C	A	12: 83,714,820	S132*	probably null	Het
Psme4	A	G	11: 30,878,415	T1812A	probably damaging	Het
Rasgrf1	T	C	9: 89,915,482		probably benign	Het
Reep3	A	G	10: 67,021,739		probably benign	Het
Rexo4	A	T	2: 26,958,574		probably benign	Het
Rnf6	A	C	5: 146,211,658	S183R	probably damaging	Het
Scai	A	T	2: 39,103,737	M297K	probably damaging	Het
Scn9a	A	T	2: 66,483,499	S1947R	probably benign	Het
Sema6c	T	C	3: 95,172,710	C772R	possibly damaging	Het
Skint7	T	C	4: 111,980,345	S107P	possibly damaging	Het
Slc24a3	A	G	2: 145,606,795	N420D	probably benign	Het
Smc1b	T	C	15: 85,070,820	D1077G	possibly damaging	Het
Smg7	G	A	1: 152,866,648	P82L	probably damaging	Het
Sp3	A	C	2: 72,970,998	F268V	probably damaging	Het
Srms	T	C	2: 181,212,633	D47G	probably benign	Het
Ss18	A	C	18: 14,651,181	M150R	probably damaging	Het
Taf5	G	A	19: 47,074,854	R281Q	probably benign	Het
Tars	T	C	15: 11,385,173	K644R	probably benign	Het
Tctex1d1	T	C	4: 103,002,538	Y96H	probably damaging	Het
Tmtc1	T	C	6: 148,411,240	S244G	probably benign	Het
Tpr	T	C	1: 150,433,725	V1670A	possibly damaging	Het
Trpv3	A	G	11: 73,296,814		probably benign	Het
Uhrf1	G	T	17: 56,310,742	V155L	probably damaging	Het
Ush2a	G	A	1: 188,400,278	C899Y	probably damaging	Het
Vmn2r115	G	A	17: 23,359,275	R574H	probably benign	Het
Vmn2r63	T	C	7: 42,928,010	D368G	probably benign	Het
Vps13a	A	G	19: 16,780,741	V10A	probably damaging	Het
Wbp11	A	G	6: 136,814,638		probably benign	Het
Zcwpw1	A	G	5: 137,799,592	D145G	probably benign	Het
Zfp607a	G	A	7: 27,878,476	V324I	probably damaging	Het
Zfp618	A	G	4: 63,133,774	I931V	probably benign	Het
Zfp821	T	C	8: 109,724,542	V389A	possibly damaging	Het
Zfp976	T	A	7: 42,613,717	H232L	probably damaging	Het

Other mutations in Tinag

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01450:Tinag	APN	9	77045576	missense	possibly damaging	0.93
IGL01524:Tinag	APN	9	77045538	missense	probably damaging	1.00
IGL01537:Tinag	APN	9	77045603	missense	probably benign	0.01
IGL01832:Tinag	APN	9	77031756	missense	probably benign	0.18
IGL02512:Tinag	APN	9	77031787	splice site	probably benign
IGL02888:Tinag	APN	9	77031713	missense	probably benign	0.24
G1citation:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R0179:Tinag	UTSW	9	76996882	splice site	probably benign
R0200:Tinag	UTSW	9	76951935	missense	probably damaging	1.00
R0206:Tinag	UTSW	9	76999852	missense	probably damaging	1.00
R0545:Tinag	UTSW	9	77031710	missense	possibly damaging	0.61
R0666:Tinag	UTSW	9	77005687	missense	probably benign	0.02
R0732:Tinag	UTSW	9	77001654	missense	possibly damaging	0.93
R1445:Tinag	UTSW	9	77045516	missense	probably damaging	1.00
R2318:Tinag	UTSW	9	77045411	missense	probably damaging	1.00
R3809:Tinag	UTSW	9	76951905	missense	probably benign	0.15
R4747:Tinag	UTSW	9	76996956	missense	probably benign
R4781:Tinag	UTSW	9	76996950	missense	possibly damaging	0.69
R5110:Tinag	UTSW	9	76952007	missense	probably damaging	1.00
R5328:Tinag	UTSW	9	77005631	nonsense	probably null
R5605:Tinag	UTSW	9	77045412	missense	probably damaging	1.00
R5897:Tinag	UTSW	9	77045444	missense	probably damaging	1.00
R6296:Tinag	UTSW	9	76996935	missense	possibly damaging	0.67
R6822:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R6915:Tinag	UTSW	9	77001615	missense	probably damaging	1.00
R7285:Tinag	UTSW	9	77045661	missense	probably benign
R7334:Tinag	UTSW	9	77001649	missense	probably damaging	1.00
R7974:Tinag	UTSW	9	76999849	missense	probably benign	0.01
R8354:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R8454:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R9029:Tinag	UTSW	9	77027014	splice site	probably benign
R9072:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9073:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9508:Tinag	UTSW	9	77005699	missense	probably damaging	1.00
Z1177:Tinag	UTSW	9	77045498	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAGGAATGTCCTACGCACATAGC -3'
(R):5'- TCTGGTTCTTGCCAGTGAATCCG -3'

Sequencing Primer
(F):5'- TTCCTCTGGCTCAGGGAAC -3'
(R):5'- TGCCAGTGAATCCGTGCAG -3'

Posted On

2013-07-30